EMAIL THIS PAGE TO A FRIEND

FAM47B

family with sequence similarity 47, member B

31 Gene Product Result for
Species: Human FAM47B(170062)
UniProtKB ID: Q8NA70, Q5JQN5, Q6PIG3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152631 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152521 MISSION® esiRNA esiRNA human FAM47B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152631 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234488 predicted 1818
2 SASI_Hs01_00234489 predicted 1568
3 SASI_Hs01_00234490 predicted 1657
4 SASI_Hs01_00234491 predicted 1800
5 SASI_Hs01_00234492 predicted 842
6 SASI_Hs01_00234493 predicted 1847
7 SASI_Hs01_00234494 predicted 739
8 SASI_Hs01_00234495 predicted 1131
9 SASI_Hs01_00234496 predicted 1536
10 SASI_Hs01_00234497 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152631
FAM47B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 47, member B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1873s1c1
Sequence:CCGGGACTCTGTTAAGACTCCTATTCTCGAGAATAGGAGTCTTAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1065s1c1
Sequence:CCGGGAAACTGGATTCTGAGAAGAACTCGAGTTCTTCTCAGAATCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1360s1c1
Sequence:CCGGGAGTGTGTTTCTGACTCTCTTCTCGAGAAGAGAGTCAGAAACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-548s1c1
Sequence:CCGGCCGAGTCTGGTAAATATCCCTCTCGAGAGGGATATTTACCAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1135s1c1
Sequence:CCGGGAACTCACCAAGCCTGGTAAACTCGAGTTTACCAGGCTTGGTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1621s1c1
Sequence:CCGGGCACCGCATTCTTATAGTGCACTCGAGTGCACTATAAGAATGCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1054s1c1
Sequence:CCGGCTACAGGTGCTGAAACTGGATCTCGAGATCCAGTTTCAGCACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1349s1c1
Sequence:CCGGCAAGCACAATGGAGTGTGTTTCTCGAGAAACACACTCCATTGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1447s1c1
Sequence:CCGGGAATCCATCAGCAGTCTGTTTCTCGAGAAACAGACTGCTGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1142s1c1
Sequence:CCGGCCAAGCCTGGTAAATACCATTCTCGAGAATGGTATTTACCAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1653s1c1
Sequence:CCGGGATAAGGTATGGACCATGGTACTCGAGTACCATGGTCCATACCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1524s1c1
Sequence:CCGGCGAGTGTGCTTCAAGGCTGATCTCGAGATCAGCCTTGAAGCACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1757s1c1
Sequence:CCGGCCGACATTCTTGACGGTCTTTCTCGAGAAAGACCGTCAAGAATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152631
FAM47B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 47, member B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1873s1c1
Sequence:CCGGGACTCTGTTAAGACTCCTATTCTCGAGAATAGGAGTCTTAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1065s1c1
Sequence:CCGGGAAACTGGATTCTGAGAAGAACTCGAGTTCTTCTCAGAATCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1360s1c1
Sequence:CCGGGAGTGTGTTTCTGACTCTCTTCTCGAGAAGAGAGTCAGAAACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-548s1c1
Sequence:CCGGCCGAGTCTGGTAAATATCCCTCTCGAGAGGGATATTTACCAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1135s1c1
Sequence:CCGGGAACTCACCAAGCCTGGTAAACTCGAGTTTACCAGGCTTGGTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1621s1c1
Sequence:CCGGGCACCGCATTCTTATAGTGCACTCGAGTGCACTATAAGAATGCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1054s1c1
Sequence:CCGGCTACAGGTGCTGAAACTGGATCTCGAGATCCAGTTTCAGCACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1349s1c1
Sequence:CCGGCAAGCACAATGGAGTGTGTTTCTCGAGAAACACACTCCATTGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1447s1c1
Sequence:CCGGGAATCCATCAGCAGTCTGTTTCTCGAGAAACAGACTGCTGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1142s1c1
Sequence:CCGGCCAAGCCTGGTAAATACCATTCTCGAGAATGGTATTTACCAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1653s1c1
Sequence:CCGGGATAAGGTATGGACCATGGTACTCGAGTACCATGGTCCATACCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1524s1c1
Sequence:CCGGCGAGTGTGCTTCAAGGCTGATCTCGAGATCAGCCTTGAAGCACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1757s1c1
Sequence:CCGGCCGACATTCTTGACGGTCTTTCTCGAGAAAGACCGTCAAGAATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152631
FAM47B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 47, member B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1873s1c1
Sequence:CCGGGACTCTGTTAAGACTCCTATTCTCGAGAATAGGAGTCTTAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1065s1c1
Sequence:CCGGGAAACTGGATTCTGAGAAGAACTCGAGTTCTTCTCAGAATCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1360s1c1
Sequence:CCGGGAGTGTGTTTCTGACTCTCTTCTCGAGAAGAGAGTCAGAAACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-548s1c1
Sequence:CCGGCCGAGTCTGGTAAATATCCCTCTCGAGAGGGATATTTACCAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1135s1c1
Sequence:CCGGGAACTCACCAAGCCTGGTAAACTCGAGTTTACCAGGCTTGGTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1621s1c1
Sequence:CCGGGCACCGCATTCTTATAGTGCACTCGAGTGCACTATAAGAATGCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1054s1c1
Sequence:CCGGCTACAGGTGCTGAAACTGGATCTCGAGATCCAGTTTCAGCACCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1349s1c1
Sequence:CCGGCAAGCACAATGGAGTGTGTTTCTCGAGAAACACACTCCATTGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1447s1c1
Sequence:CCGGGAATCCATCAGCAGTCTGTTTCTCGAGAAACAGACTGCTGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152631.1-1142s1c1
Sequence:CCGGCCAAGCCTGGTAAATACCATTCTCGAGAATGGTATTTACCAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1653s1c1
Sequence:CCGGGATAAGGTATGGACCATGGTACTCGAGTACCATGGTCCATACCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1524s1c1
Sequence:CCGGCGAGTGTGCTTCAAGGCTGATCTCGAGATCAGCCTTGAAGCACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152631.1-1757s1c1
Sequence:CCGGCCGACATTCTTGACGGTCTTTCTCGAGAAAGACCGTCAAGAATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks