EMAIL THIS PAGE TO A FRIEND

FAM47C

family with sequence similarity 47, member C

36 Gene Product Result for
UniProtKB ID: Q5HY64, Q6ZU46
Gene ID:
Human(442444) Summary: This gene encodes a product belonging to a family of proteins with unknown function. The coding sequence of this family member includes several tandemly repeated regions. [provided by RefSeq, Sep 2011]
Mouse(70864) family with sequence similarity 47, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013736 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001164739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013736 Rosetta Predictions human pricing
XM_135940 Rosetta Predictions mouse pricing
XM_980994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033586 predicted 1523
2 SASI_Hs01_00033587 predicted 2491
3 SASI_Hs01_00033588 predicted 2494
4 SASI_Hs01_00033589 predicted 2788
5 SASI_Hs01_00033590 predicted 1440
6 SASI_Hs01_00033591 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250841 predicted 1141
2 SASI_Mm01_00250842 predicted 827
3 SASI_Mm01_00250843 predicted 788
4 SASI_Mm02_00424644 predicted 550
5 SASI_Mm01_00250844 predicted 1240
6 SASI_Mm01_00250847 predicted 764
7 SASI_Mm02_00424645 predicted 492
8 SASI_Mm02_00424646 predicted 648
9 SASI_Mm02_00424647 predicted 593
10 SASI_Mm01_00250849 predicted 837
11 SASI_Mm01_00250845 predicted 936
12 SASI_Mm01_00250846 predicted 1195
13 SASI_Mm01_00250848 predicted 1139
14 SASI_Mm01_00250850 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447461 predicted 1137
2 SASI_Mm02_00447462 predicted 825
3 SASI_Mm02_00447463 predicted 788
4 SASI_Mm02_00447464 predicted 548
5 SASI_Mm02_00447465 predicted 1246
6 SASI_Mm02_00447466 predicted 761
7 SASI_Mm02_00447467 predicted 497
8 SASI_Mm02_00447468 predicted 654
9 SASI_Mm02_00447469 predicted 596
10 SASI_Mm02_00447470 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013736
FAM47C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 47, member C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2787s1c1
Sequence:CCGGGCACCAAATTCTCATAGTGCACTCGAGTGCACTATGAGAATTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2864s1c1
Sequence:CCGGGCTAAGAAGTGATGAACCTTTCTCGAGAAAGGTTCATCACTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2726s1c1
Sequence:CCGGCGAAATGGATGAGGTCAAATTCTCGAGAATTTGACCTCATCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-205s1c1
Sequence:CCGGCTCCTGAAGATACGCTTGTTTCTCGAGAAACAAGCGTATCTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-1629s1c1
Sequence:CCGGCCTGAGAGTAGCGTATCTCATCTCGAGATGAGATACGCTACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013736
FAM47C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 47, member C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2787s1c1
Sequence:CCGGGCACCAAATTCTCATAGTGCACTCGAGTGCACTATGAGAATTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2864s1c1
Sequence:CCGGGCTAAGAAGTGATGAACCTTTCTCGAGAAAGGTTCATCACTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2726s1c1
Sequence:CCGGCGAAATGGATGAGGTCAAATTCTCGAGAATTTGACCTCATCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-205s1c1
Sequence:CCGGCTCCTGAAGATACGCTTGTTTCTCGAGAAACAAGCGTATCTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-1629s1c1
Sequence:CCGGCCTGAGAGTAGCGTATCTCATCTCGAGATGAGATACGCTACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013736
FAM47C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 47, member C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2787s1c1
Sequence:CCGGGCACCAAATTCTCATAGTGCACTCGAGTGCACTATGAGAATTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2864s1c1
Sequence:CCGGGCTAAGAAGTGATGAACCTTTCTCGAGAAAGGTTCATCACTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-2726s1c1
Sequence:CCGGCGAAATGGATGAGGTCAAATTCTCGAGAATTTGACCTCATCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-205s1c1
Sequence:CCGGCTCCTGAAGATACGCTTGTTTCTCGAGAAACAAGCGTATCTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013736.1-1629s1c1
Sequence:CCGGCCTGAGAGTAGCGTATCTCATCTCGAGATGAGATACGCTACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164739
FAM47C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 47, member C
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1137s21c1
Sequence:CCGGAGACATCATTGAAGATCTTTACTCGAGTAAAGATCTTCAATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-716s21c1
Sequence:CCGGCCGCCAAGCAGTCTCTTTATTCTCGAGAATAAAGAGACTGCTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1004s21c1
Sequence:CCGGAGTCCAACAGGGATAAGATTACTCGAGTAATCTTATCCCTGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-266s21c1
Sequence:CCGGCTAGTGAAGGTATGATCATTCCTCGAGGAATGATCATACCTTCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164739.1-1359s21c1
Sequence:CCGGTACTTGACTTTACTCTCATTTCTCGAGAAATGAGAGTAAAGTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1087s21c1
Sequence:CCGGATGGACCCTGAAGAGTTATTTCTCGAGAAATAACTCTTCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164739
FAM47C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 47, member C
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1137s21c1
Sequence:CCGGAGACATCATTGAAGATCTTTACTCGAGTAAAGATCTTCAATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-716s21c1
Sequence:CCGGCCGCCAAGCAGTCTCTTTATTCTCGAGAATAAAGAGACTGCTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1004s21c1
Sequence:CCGGAGTCCAACAGGGATAAGATTACTCGAGTAATCTTATCCCTGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-266s21c1
Sequence:CCGGCTAGTGAAGGTATGATCATTCCTCGAGGAATGATCATACCTTCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164739.1-1359s21c1
Sequence:CCGGTACTTGACTTTACTCTCATTTCTCGAGAAATGAGAGTAAAGTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1087s21c1
Sequence:CCGGATGGACCCTGAAGAGTTATTTCTCGAGAAATAACTCTTCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164739
FAM47C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 47, member C
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1137s21c1
Sequence:CCGGAGACATCATTGAAGATCTTTACTCGAGTAAAGATCTTCAATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-716s21c1
Sequence:CCGGCCGCCAAGCAGTCTCTTTATTCTCGAGAATAAAGAGACTGCTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1004s21c1
Sequence:CCGGAGTCCAACAGGGATAAGATTACTCGAGTAATCTTATCCCTGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-266s21c1
Sequence:CCGGCTAGTGAAGGTATGATCATTCCTCGAGGAATGATCATACCTTCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164739.1-1359s21c1
Sequence:CCGGTACTTGACTTTACTCTCATTTCTCGAGAAATGAGAGTAAAGTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164739.1-1087s21c1
Sequence:CCGGATGGACCCTGAAGAGTTATTTCTCGAGAAATAACTCTTCAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks