EMAIL THIS PAGE TO A FRIEND

FAM47E

family with sequence similarity 47, member E

87 Gene Product Result for
UniProtKB ID: Q6ZV65, D6R8Y4
Gene ID:
Mouse(384198) family with sequence similarity 47, member E
Rat(686140) family with sequence similarity 47, member E
chicken(422643) family with sequence similarity 47, member E
chicken(101751418) family with sequence similarity 47, member E
cow(508540) family with sequence similarity 47, member E
domestic cat(101091365) family with sequence similarity 47, member E
dog(100686215) family with sequence similarity 47, member E
chicken(101667315) family with sequence similarity 47, member E
sheep(101105754) family with sequence similarity 47, member E
domestic guinea pig(101788729) family with sequence similarity 47, member E
naked mole-rat(101696978) family with sequence similarity 47, member E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136570 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720937 Rosetta Predictions human pricing
XM_001720938 Rosetta Predictions human pricing
XM_001721008 Rosetta Predictions human pricing
XM_001721012 Rosetta Predictions human pricing
XM_001722510 Rosetta Predictions human pricing
XM_001722512 Rosetta Predictions human pricing
XM_001066663 Rosetta Predictions rat pricing
NM_001033478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00439768 predicted 1046
2 SASI_Hs02_00439769 predicted 710
3 SASI_Hs02_00439770 predicted 527
4 SASI_Hs02_00439771 predicted 1113
5 SASI_Hs02_00439772 predicted 592
6 SASI_Hs02_00439773 predicted 682
7 SASI_Hs02_00439774 predicted 994
8 SASI_Hs02_00439775 predicted 895
9 SASI_Hs02_00439776 predicted 697
10 SASI_Hs02_00439777 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00439778 predicted 1092
2 SASI_Hs02_00439779 predicted 750
3 SASI_Hs02_00439780 predicted 526
4 SASI_Hs02_00439781 predicted 705
5 SASI_Hs02_00439782 predicted 1156
6 SASI_Hs02_00439783 predicted 734
7 SASI_Hs02_00439784 predicted 1037
8 SASI_Hs02_00439785 predicted 931
9 SASI_Hs02_00439786 predicted 748
10 SASI_Hs02_00439787 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00440206 predicted 1045
2 SASI_Hs02_00440207 predicted 709
3 SASI_Hs02_00440208 predicted 526
4 SASI_Hs02_00440209 predicted 1113
5 SASI_Hs02_00440210 predicted 597
6 SASI_Hs02_00440211 predicted 683
7 SASI_Hs02_00440212 predicted 991
8 SASI_Hs02_00440213 predicted 895
9 SASI_Hs02_00440214 predicted 704
10 SASI_Hs02_00440215 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00440236 predicted 1087
2 SASI_Hs02_00440237 predicted 748
3 SASI_Hs02_00440238 predicted 518
4 SASI_Hs02_00440239 predicted 703
5 SASI_Hs02_00440240 predicted 1158
6 SASI_Hs02_00440241 predicted 728
7 SASI_Hs02_00440242 predicted 1042
8 SASI_Hs02_00440243 predicted 940
9 SASI_Hs02_00440244 predicted 747
10 SASI_Hs02_00440245 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00449618 predicted 1043
2 SASI_Hs02_00449619 predicted 706
3 SASI_Hs02_00449620 predicted 527
4 SASI_Hs02_00449621 predicted 1114
5 SASI_Hs02_00449622 predicted 593
6 SASI_Hs02_00449623 predicted 689
7 SASI_Hs02_00449624 predicted 997
8 SASI_Hs02_00449625 predicted 890
9 SASI_Hs02_00449626 predicted 703
10 SASI_Hs02_00449627 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00449628 predicted 1089
2 SASI_Hs02_00449629 predicted 753
3 SASI_Hs02_00449630 predicted 527
4 SASI_Hs02_00449631 predicted 701
5 SASI_Hs02_00449632 predicted 1164
6 SASI_Hs02_00449633 predicted 730
7 SASI_Hs02_00449634 predicted 1042
8 SASI_Hs02_00449635 predicted 936
9 SASI_Hs02_00449636 predicted 741
10 SASI_Hs02_00449637 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318353 predicted 687
2 SASI_Rn02_00318354 predicted 602
3 SASI_Rn02_00318355 predicted 461
4 SASI_Rn02_00318356 predicted 581
5 SASI_Rn02_00318357 predicted 588
6 SASI_Rn02_00318358 predicted 513
7 SASI_Rn02_00318359 predicted 559
8 SASI_Rn02_00318360 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089601 predicted 624
2 SASI_Mm01_00089602 predicted 613
3 SASI_Mm01_00089603 predicted 684
4 SASI_Mm01_00089604 predicted 684
5 SASI_Mm01_00089605 predicted 716
6 SASI_Mm01_00089606 predicted 533
7 SASI_Mm01_00089607 predicted 534
8 SASI_Mm01_00089608 predicted 605
9 SASI_Mm01_00089609 predicted 673
10 SASI_Mm02_00288839 predicted 533
11 SASI_Mm01_00089610 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033478
FAM47E MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 47, member E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-570s21c1
Sequence:CCGGAGAGGCAAAGAGCGGATGAACCTCGAGGTTCATCCGCTCTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-734s21c1
Sequence:CCGGAGGTTCCTTGAGAAGATATATCTCGAGATATATCTTCTCAAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-694s21c1
Sequence:CCGGCTTTAAGGACTTCATTCTAAGCTCGAGCTTAGAATGAAGTCCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-679s21c1
Sequence:CCGGGCGAGGGACAGCAGCCTTTAACTCGAGTTAAAGGCTGCTGTCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-619s21c1
Sequence:CCGGAGCTCAAGATTCAACCTTTAACTCGAGTTAAAGGTTGAATCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033478
FAM47E MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 47, member E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-570s21c1
Sequence:CCGGAGAGGCAAAGAGCGGATGAACCTCGAGGTTCATCCGCTCTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-734s21c1
Sequence:CCGGAGGTTCCTTGAGAAGATATATCTCGAGATATATCTTCTCAAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-694s21c1
Sequence:CCGGCTTTAAGGACTTCATTCTAAGCTCGAGCTTAGAATGAAGTCCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-679s21c1
Sequence:CCGGGCGAGGGACAGCAGCCTTTAACTCGAGTTAAAGGCTGCTGTCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-619s21c1
Sequence:CCGGAGCTCAAGATTCAACCTTTAACTCGAGTTAAAGGTTGAATCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033478
FAM47E MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 47, member E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-570s21c1
Sequence:CCGGAGAGGCAAAGAGCGGATGAACCTCGAGGTTCATCCGCTCTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-734s21c1
Sequence:CCGGAGGTTCCTTGAGAAGATATATCTCGAGATATATCTTCTCAAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-694s21c1
Sequence:CCGGCTTTAAGGACTTCATTCTAAGCTCGAGCTTAGAATGAAGTCCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-679s21c1
Sequence:CCGGGCGAGGGACAGCAGCCTTTAACTCGAGTTAAAGGCTGCTGTCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033478.1-619s21c1
Sequence:CCGGAGCTCAAGATTCAACCTTTAACTCGAGTTAAAGGTTGAATCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136570
FAM47E MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 47, member E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136570.1-1264s21c1
Sequence:CCGGTACTACGTACTTGGCTATTTCCTCGAGGAAATAGCCAAGTACGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-947s21c1
Sequence:CCGGGAGGTATGGAGCATGGTATTTCTCGAGAAATACCATGCTCCATACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-454s21c1
Sequence:CCGGCTATGCCCATAGAGCTCTTATCTCGAGATAAGAGCTCTATGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-1192s21c1
Sequence:CCGGCATGTAATAAGACTCCTATAACTCGAGTTATAGGAGTCTTATTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-169s21c1
Sequence:CCGGACAGCCGGCAGTTGGTATTTCCTCGAGGAAATACCAACTGCCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136570
FAM47E MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 47, member E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136570.1-1264s21c1
Sequence:CCGGTACTACGTACTTGGCTATTTCCTCGAGGAAATAGCCAAGTACGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-947s21c1
Sequence:CCGGGAGGTATGGAGCATGGTATTTCTCGAGAAATACCATGCTCCATACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-454s21c1
Sequence:CCGGCTATGCCCATAGAGCTCTTATCTCGAGATAAGAGCTCTATGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-1192s21c1
Sequence:CCGGCATGTAATAAGACTCCTATAACTCGAGTTATAGGAGTCTTATTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-169s21c1
Sequence:CCGGACAGCCGGCAGTTGGTATTTCCTCGAGGAAATACCAACTGCCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136570
FAM47E MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 47, member E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136570.1-1264s21c1
Sequence:CCGGTACTACGTACTTGGCTATTTCCTCGAGGAAATAGCCAAGTACGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-947s21c1
Sequence:CCGGGAGGTATGGAGCATGGTATTTCTCGAGAAATACCATGCTCCATACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-454s21c1
Sequence:CCGGCTATGCCCATAGAGCTCTTATCTCGAGATAAGAGCTCTATGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-1192s21c1
Sequence:CCGGCATGTAATAAGACTCCTATAACTCGAGTTATAGGAGTCTTATTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136570.1-169s21c1
Sequence:CCGGACAGCCGGCAGTTGGTATTTCCTCGAGGAAATACCAACTGCCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks