EMAIL THIS PAGE TO A FRIEND

FAM49A

family with sequence similarity 49, member A

60 Gene Product Result for
UniProtKB ID: Q9H0Q0
Gene ID:
Mouse(76820) family with sequence similarity 49, member A
Rat(298890) family with sequence similarity 49, member A
domestic guinea pig(100733482) family with sequence similarity 49, member A
naked mole-rat(101716730) family with sequence similarity 49, member A
sheep(101122507) family with sequence similarity 49, member A
Zebrafish(445212) family with sequence similarity 49, member A
cow(504763) family with sequence similarity 49, member A
domestic cat(101084616) family with sequence similarity 49, member A
chicken(421949) family with sequence similarity 49, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030797 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030797 Rosetta Predictions human pricing
NM_001106718 Rosetta Predictions rat pricing
NM_029758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238445 predicted 1043
2 SASI_Hs01_00238446 predicted 419
3 SASI_Hs01_00238447 predicted 927
4 SASI_Hs02_00358356 predicted 981
5 SASI_Hs01_00238448 predicted 914
6 SASI_Hs01_00238449 predicted 731
7 SASI_Hs01_00238451 predicted 1253
8 SASI_Hs01_00238452 predicted 747
9 SASI_Hs01_00238453 predicted 1178
10 SASI_Hs02_00358357 predicted 387
11 SASI_Hs01_00238450 predicted 696
12 SASI_Hs01_00238454 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221708 predicted 1121
2 SASI_Rn02_00221709 predicted 491
3 SASI_Rn02_00221710 predicted 493
4 SASI_Rn02_00221711 predicted 634
5 SASI_Rn02_00221712 predicted 799
6 SASI_Rn02_00221713 predicted 392
7 SASI_Rn02_00221714 predicted 859
8 SASI_Rn02_00221715 predicted 366
9 SASI_Rn02_00221716 predicted 203
10 SASI_Rn02_00221717 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092056 predicted 690
2 SASI_Mm01_00092057 predicted 1157
3 SASI_Mm01_00092058 predicted 1142
4 SASI_Mm01_00092059 predicted 1269
5 SASI_Mm01_00092060 predicted 271
6 SASI_Mm01_00092062 predicted 817
7 SASI_Mm01_00092063 predicted 736
8 SASI_Mm01_00092064 predicted 818
9 SASI_Mm02_00335886 predicted 1244
10 SASI_Mm01_00092065 predicted 1078
11 SASI_Mm01_00092061 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029758
FAM49A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 49, member A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029758.4-996s21c1
Sequence:CCGGGTACGATGACAAGCGTCTGTACTCGAGTACAGACGCTTGTCATCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029758.4-907s21c1
Sequence:CCGGACCGATGTTGAAGACTCTTAGCTCGAGCTAAGAGTCTTCAACATCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029758.3-2851s1c1
Sequence:CCGGGCCTGTTTGATTACTTGTAAACTCGAGTTTACAAGTAATCAAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-1160s1c1
Sequence:CCGGGAATGATGAATCGACTTCCAACTCGAGTTGGAAGTCGATTCATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-614s1c1
Sequence:CCGGCGCAAAGGAATTTGCAGAAATCTCGAGATTTCTGCAAATTCCTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-411s1c1
Sequence:CCGGCCAGAGATCCGAGATGCAATTCTCGAGAATTGCATCTCGGATCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029758
FAM49A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 49, member A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029758.4-996s21c1
Sequence:CCGGGTACGATGACAAGCGTCTGTACTCGAGTACAGACGCTTGTCATCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029758.4-907s21c1
Sequence:CCGGACCGATGTTGAAGACTCTTAGCTCGAGCTAAGAGTCTTCAACATCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029758.3-2851s1c1
Sequence:CCGGGCCTGTTTGATTACTTGTAAACTCGAGTTTACAAGTAATCAAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-1160s1c1
Sequence:CCGGGAATGATGAATCGACTTCCAACTCGAGTTGGAAGTCGATTCATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-614s1c1
Sequence:CCGGCGCAAAGGAATTTGCAGAAATCTCGAGATTTCTGCAAATTCCTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-411s1c1
Sequence:CCGGCCAGAGATCCGAGATGCAATTCTCGAGAATTGCATCTCGGATCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029758
FAM49A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 49, member A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029758.4-996s21c1
Sequence:CCGGGTACGATGACAAGCGTCTGTACTCGAGTACAGACGCTTGTCATCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029758.4-907s21c1
Sequence:CCGGACCGATGTTGAAGACTCTTAGCTCGAGCTAAGAGTCTTCAACATCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029758.3-2851s1c1
Sequence:CCGGGCCTGTTTGATTACTTGTAAACTCGAGTTTACAAGTAATCAAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-1160s1c1
Sequence:CCGGGAATGATGAATCGACTTCCAACTCGAGTTGGAAGTCGATTCATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-614s1c1
Sequence:CCGGCGCAAAGGAATTTGCAGAAATCTCGAGATTTCTGCAAATTCCTTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029758.3-411s1c1
Sequence:CCGGCCAGAGATCCGAGATGCAATTCTCGAGAATTGCATCTCGGATCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030797
FAM49A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 49, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030797.1-728s1c1
Sequence:CCGGGCACCTAGACATTGAGAATGACTCGAGTCATTCTCAATGTCTAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030797.1-1220s1c1
Sequence:CCGGCTGACCTCAGAAGATGTATATCTCGAGATATACATCTTCTGAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030797.1-767s1c1
Sequence:CCGGCAATCGAATGTCCCTCTTCTACTCGAGTAGAAGAGGGACATTCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030797.1-1219s1c1
Sequence:CCGGGCTGACCTCAGAAGATGTATACTCGAGTATACATCTTCTGAGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030797.1-1292s1c1
Sequence:CCGGCGTTTCCTTCTTGTCACTGAACTCGAGTTCAGTGACAAGAAGGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030797
FAM49A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 49, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030797.1-728s1c1
Sequence:CCGGGCACCTAGACATTGAGAATGACTCGAGTCATTCTCAATGTCTAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030797.1-1220s1c1
Sequence:CCGGCTGACCTCAGAAGATGTATATCTCGAGATATACATCTTCTGAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030797.1-767s1c1
Sequence:CCGGCAATCGAATGTCCCTCTTCTACTCGAGTAGAAGAGGGACATTCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030797.1-1219s1c1
Sequence:CCGGGCTGACCTCAGAAGATGTATACTCGAGTATACATCTTCTGAGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030797.1-1292s1c1
Sequence:CCGGCGTTTCCTTCTTGTCACTGAACTCGAGTTCAGTGACAAGAAGGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030797
FAM49A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 49, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030797.1-728s1c1
Sequence:CCGGGCACCTAGACATTGAGAATGACTCGAGTCATTCTCAATGTCTAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030797.1-1220s1c1
Sequence:CCGGCTGACCTCAGAAGATGTATATCTCGAGATATACATCTTCTGAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030797.1-767s1c1
Sequence:CCGGCAATCGAATGTCCCTCTTCTACTCGAGTAGAAGAGGGACATTCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030797.1-1219s1c1
Sequence:CCGGGCTGACCTCAGAAGATGTATACTCGAGTATACATCTTCTGAGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030797.1-1292s1c1
Sequence:CCGGCGTTTCCTTCTTGTCACTGAACTCGAGTTCAGTGACAAGAAGGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)