EMAIL THIS PAGE TO A FRIEND

FAM49B

family with sequence similarity 49, member B

105 Gene Product Result for
Synonyms: L1
UniProtKB ID: Q9NUQ9, Q96AZ5, Q9NZE7
Gene ID:
Mouse(223601) family with sequence similarity 49, member B
Rat(299909) family with sequence similarity 49, member B
chicken(420330) family with sequence similarity 49, member B
cow(510019) family with sequence similarity 49, member B
domestic cat(101087300) family with sequence similarity 49, member B
dog(482041) family with sequence similarity 49, member B
sheep(101103327) family with sequence similarity 49, member B
naked mole-rat(101700702) family with sequence similarity 49, member B
domestic guinea pig(100723807) family with sequence similarity 49, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA009076 Anti-FAM49B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016623 Rosetta Predictions human pricing
NM_001126267 Rosetta Predictions rat pricing
NM_144846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110480 predicted 1310
2 SASI_Hs01_00110482 predicted 1093
3 SASI_Hs02_00349787 predicted 1318
4 SASI_Hs01_00110483 predicted 984
5 SASI_Hs01_00110484 predicted 798
6 SASI_Hs01_00110486 predicted 997
7 SASI_Hs01_00110487 predicted 1514
8 SASI_Hs01_00110488 predicted 1255
9 SASI_Hs01_00110489 predicted 1396
10 SASI_Hs02_00349788 predicted 1332
11 SASI_Hs01_00110481 predicted 1080
12 SASI_Hs01_00110485 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253043 predicted 770
2 SASI_Rn02_00253044 predicted 702
3 SASI_Rn02_00253045 predicted 730
4 SASI_Rn02_00253046 predicted 707
5 SASI_Rn02_00253047 predicted 1253
6 SASI_Rn02_00253048 predicted 1089
7 SASI_Rn02_00253049 predicted 1298
8 SASI_Rn02_00253050 predicted 1263
9 SASI_Rn02_00253051 predicted 680
10 SASI_Rn02_00253052 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083875 predicted 1059
2 SASI_Mm01_00083876 predicted 834
3 SASI_Mm01_00083878 predicted 899
4 SASI_Mm01_00083879 predicted 446
5 SASI_Mm01_00083880 predicted 1356
6 SASI_Mm01_00083881 predicted 1172
7 SASI_Mm01_00083882 predicted 734
8 SASI_Mm01_00083883 predicted 1145
9 SASI_Mm01_00083884 predicted 771
10 SASI_Mm02_00340246 predicted 1363
11 SASI_Mm01_00083877 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144846
VALIDATED
FAM49B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 49, member B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.2-903s1c1
Sequence:CCGGCCTTAAGTGATGCAACAACAACTCGAGTTGTTGTTGCATCACTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144846.2-2437s1c1
Sequence:CCGGGCTGCTTGAAAGTTGTCGAATCTCGAGATTCGACAACTTTCAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144846.2-3241s1c1
Sequence:CCGGGCCACCTAGTTTGTGGTAATTCTCGAGAATTACCACAAACTAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1504s21c1
Sequence:CCGGGCCATCTAAGGCAGCTAATTACTCGAGTAATTAGCTGCCTTAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-789s21c1
Sequence:CCGGATTGAGTCGTATGAGAATTAACTCGAGTTAATTCTCATACGACTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.4-391s1c1
Sequence:CCGGGAGTCTGAGAAGGAAATATATCTCGAGATATATTTCCTTCTCAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.4-792s1c1
Sequence:CCGGGAGTCGTATGAGAATTAATAACTCGAGTTATTAATTCTCATACGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1138s21c1
Sequence:CCGGATTGATATGAAAGGTTGTATCCTCGAGGATACAACCTTTCATATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1070s21c1
Sequence:CCGGTAATGGTGGGTGTCATAATACCTCGAGGTATTATGACACCCACCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1015s21c1
Sequence:CCGGCCGGAATACAGAAGCAGATTTCTCGAGAAATCTGCTTCTGTATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144846
VALIDATED
FAM49B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 49, member B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.2-903s1c1
Sequence:CCGGCCTTAAGTGATGCAACAACAACTCGAGTTGTTGTTGCATCACTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144846.2-2437s1c1
Sequence:CCGGGCTGCTTGAAAGTTGTCGAATCTCGAGATTCGACAACTTTCAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144846.2-3241s1c1
Sequence:CCGGGCCACCTAGTTTGTGGTAATTCTCGAGAATTACCACAAACTAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1504s21c1
Sequence:CCGGGCCATCTAAGGCAGCTAATTACTCGAGTAATTAGCTGCCTTAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-789s21c1
Sequence:CCGGATTGAGTCGTATGAGAATTAACTCGAGTTAATTCTCATACGACTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.4-391s1c1
Sequence:CCGGGAGTCTGAGAAGGAAATATATCTCGAGATATATTTCCTTCTCAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.4-792s1c1
Sequence:CCGGGAGTCGTATGAGAATTAATAACTCGAGTTATTAATTCTCATACGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1138s21c1
Sequence:CCGGATTGATATGAAAGGTTGTATCCTCGAGGATACAACCTTTCATATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1070s21c1
Sequence:CCGGTAATGGTGGGTGTCATAATACCTCGAGGTATTATGACACCCACCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1015s21c1
Sequence:CCGGCCGGAATACAGAAGCAGATTTCTCGAGAAATCTGCTTCTGTATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144846
VALIDATED
FAM49B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 49, member B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.2-903s1c1
Sequence:CCGGCCTTAAGTGATGCAACAACAACTCGAGTTGTTGTTGCATCACTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144846.2-2437s1c1
Sequence:CCGGGCTGCTTGAAAGTTGTCGAATCTCGAGATTCGACAACTTTCAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144846.2-3241s1c1
Sequence:CCGGGCCACCTAGTTTGTGGTAATTCTCGAGAATTACCACAAACTAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1504s21c1
Sequence:CCGGGCCATCTAAGGCAGCTAATTACTCGAGTAATTAGCTGCCTTAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-789s21c1
Sequence:CCGGATTGAGTCGTATGAGAATTAACTCGAGTTAATTCTCATACGACTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.4-391s1c1
Sequence:CCGGGAGTCTGAGAAGGAAATATATCTCGAGATATATTTCCTTCTCAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144846.4-792s1c1
Sequence:CCGGGAGTCGTATGAGAATTAATAACTCGAGTTATTAATTCTCATACGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1138s21c1
Sequence:CCGGATTGATATGAAAGGTTGTATCCTCGAGGATACAACCTTTCATATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1070s21c1
Sequence:CCGGTAATGGTGGGTGTCATAATACCTCGAGGTATTATGACACCCACCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144846.4-1015s21c1
Sequence:CCGGCCGGAATACAGAAGCAGATTTCTCGAGAAATCTGCTTCTGTATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016623
FAM49B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 49, member B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-924s1c1
Sequence:CCGGGCAGGCTCTTGCTAAACAGTTCTCGAGAACTGTTTAGCAAGAGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1299s1c1
Sequence:CCGGGTCATTCTGCTTGAGGGTAATCTCGAGATTACCCTCAAGCAGAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1545s1c1
Sequence:CCGGGCTGTAGACAGAAGACAGTATCTCGAGATACTGTCTTCTGTCTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-729s1c1
Sequence:CCGGCCACGAAATACGAGAGGCAATCTCGAGATTGCCTCTCGTATTTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1483s1c1
Sequence:CCGGGATGAGACTACCTCCAAGCAACTCGAGTTGCTTGGAGGTAGTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1569s1c1
Sequence:CCGGGCAATGACTGAGAATGCAGTTCTCGAGAACTGCATTCTCAGTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1752s1c1
Sequence:CCGGGCAGCTAATTATGCATTGCATCTCGAGATGCAATGCATAATTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1099s1c1
Sequence:CCGGGCAAATCGAATGTCTTTGTTTCTCGAGAAACAAAGACATTCGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1036s21c1
Sequence:CCGGTTGAGTCGTATGAGGATTAACCTCGAGGTTAATCCTCATACGACTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016623.3-1875s21c1
Sequence:CCGGACTGCCTATTCTGCTATTTAACTCGAGTTAAATAGCAGAATAGGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1008s21c1
Sequence:CCGGGAATGATTTCAGCTATTATAGCTCGAGCTATAATAGCTGAAATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-659s21c1
Sequence:CCGGATCAGGTGAATGTAGTATTAACTCGAGTTAATACTACATTCACCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1384s21c1
Sequence:CCGGATTGATATGAAAGGTTGTATCCTCGAGGATACAACCTTTCATATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016623
FAM49B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 49, member B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-924s1c1
Sequence:CCGGGCAGGCTCTTGCTAAACAGTTCTCGAGAACTGTTTAGCAAGAGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1299s1c1
Sequence:CCGGGTCATTCTGCTTGAGGGTAATCTCGAGATTACCCTCAAGCAGAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1545s1c1
Sequence:CCGGGCTGTAGACAGAAGACAGTATCTCGAGATACTGTCTTCTGTCTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-729s1c1
Sequence:CCGGCCACGAAATACGAGAGGCAATCTCGAGATTGCCTCTCGTATTTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1483s1c1
Sequence:CCGGGATGAGACTACCTCCAAGCAACTCGAGTTGCTTGGAGGTAGTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1569s1c1
Sequence:CCGGGCAATGACTGAGAATGCAGTTCTCGAGAACTGCATTCTCAGTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1752s1c1
Sequence:CCGGGCAGCTAATTATGCATTGCATCTCGAGATGCAATGCATAATTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1099s1c1
Sequence:CCGGGCAAATCGAATGTCTTTGTTTCTCGAGAAACAAAGACATTCGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1036s21c1
Sequence:CCGGTTGAGTCGTATGAGGATTAACCTCGAGGTTAATCCTCATACGACTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016623.3-1875s21c1
Sequence:CCGGACTGCCTATTCTGCTATTTAACTCGAGTTAAATAGCAGAATAGGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1008s21c1
Sequence:CCGGGAATGATTTCAGCTATTATAGCTCGAGCTATAATAGCTGAAATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-659s21c1
Sequence:CCGGATCAGGTGAATGTAGTATTAACTCGAGTTAATACTACATTCACCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1384s21c1
Sequence:CCGGATTGATATGAAAGGTTGTATCCTCGAGGATACAACCTTTCATATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016623
FAM49B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 49, member B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-924s1c1
Sequence:CCGGGCAGGCTCTTGCTAAACAGTTCTCGAGAACTGTTTAGCAAGAGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1299s1c1
Sequence:CCGGGTCATTCTGCTTGAGGGTAATCTCGAGATTACCCTCAAGCAGAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1545s1c1
Sequence:CCGGGCTGTAGACAGAAGACAGTATCTCGAGATACTGTCTTCTGTCTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-729s1c1
Sequence:CCGGCCACGAAATACGAGAGGCAATCTCGAGATTGCCTCTCGTATTTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1483s1c1
Sequence:CCGGGATGAGACTACCTCCAAGCAACTCGAGTTGCTTGGAGGTAGTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1569s1c1
Sequence:CCGGGCAATGACTGAGAATGCAGTTCTCGAGAACTGCATTCTCAGTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016623.3-1752s1c1
Sequence:CCGGGCAGCTAATTATGCATTGCATCTCGAGATGCAATGCATAATTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016623.3-1099s1c1
Sequence:CCGGGCAAATCGAATGTCTTTGTTTCTCGAGAAACAAAGACATTCGATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1036s21c1
Sequence:CCGGTTGAGTCGTATGAGGATTAACCTCGAGGTTAATCCTCATACGACTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016623.3-1875s21c1
Sequence:CCGGACTGCCTATTCTGCTATTTAACTCGAGTTAAATAGCAGAATAGGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1008s21c1
Sequence:CCGGGAATGATTTCAGCTATTATAGCTCGAGCTATAATAGCTGAAATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-659s21c1
Sequence:CCGGATCAGGTGAATGTAGTATTAACTCGAGTTAATACTACATTCACCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016623.3-1384s21c1
Sequence:CCGGATTGATATGAAAGGTTGTATCCTCGAGGATACAACCTTTCATATCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)