EMAIL THIS PAGE TO A FRIEND

FAM50A

family with sequence similarity 50, member A

44 Gene Product Result for
Synonyms: 9F DXS9928E HXC-26 HXC26 XAP5
UniProtKB ID: Q14320, A8KAQ4, B2R997, Q5HY37
Gene ID:
Human(9130) Summary: This gene belongs to the FAM50 family. The encoded protein is highly conserved in length and sequence across different species. It is a basic protein containing a nuclear localization signal, and may function as a DNA-binding protein or a transcriptional factor. [provided by RefSeq, Sep 2009]
Mouse(108160) family with sequence similarity 50, member A
Rat(293862) family with sequence similarity 50, member A
Zebrafish(550329) family with sequence similarity 50, member A
cow(515539) family with sequence similarity 50, member A
domestic cat(101092010) family with sequence similarity 50, member A
dog(100684336) family with sequence similarity 50, member A
domestic guinea pig(100733744) family with sequence similarity 50, member A
naked mole-rat(101706405) family with sequence similarity 50, member A
sheep(101119621) family with sequence similarity 50, member A
Domestic Rabbit(100328762) family with sequence similarity 50, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044781 MISSION® esiRNA esiRNA human FAM50A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004699 Rosetta Predictions human pricing
NM_001106344 Rosetta Predictions rat pricing
NM_138607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137461 predicted 908
2 SASI_Hs01_00137462 predicted 759
3 SASI_Hs01_00137463 predicted 909
4 SASI_Hs01_00137464 predicted 926
5 SASI_Hs01_00137465 predicted 1042
6 SASI_Hs01_00137466 predicted 939
7 SASI_Hs01_00137467 predicted 987
8 SASI_Hs01_00137468 predicted 726
9 SASI_Hs01_00137469 predicted 906
10 SASI_Hs01_00137470 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218048 predicted 1093
2 SASI_Rn02_00218049 predicted 1088
3 SASI_Rn02_00218050 predicted 1083
4 SASI_Rn02_00218051 predicted 1105
5 SASI_Rn02_00218052 predicted 1073
6 SASI_Rn02_00218053 predicted 1217
7 SASI_Rn02_00218054 predicted 1246
8 SASI_Rn02_00218055 predicted 1226
9 SASI_Rn02_00218056 predicted 1124
10 SASI_Rn02_00218057 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339682 predicted 1076
2 SASI_Mm01_00022956 predicted 979
3 SASI_Mm02_00339683 predicted 618
4 SASI_Mm01_00022957 predicted 652
5 SASI_Mm01_00022958 predicted 931
6 SASI_Mm01_00022959 predicted 375
7 SASI_Mm01_00022960 predicted 1025
8 SASI_Mm01_00022961 predicted 1097
9 SASI_Mm01_00022962 predicted 699
10 SASI_Mm01_00022963 predicted 865
11 SASI_Mm01_00022955 predicted 876
12 SASI_Mm01_00022964 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004699
VALIDATED
FAM50A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 50, member A
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-226s21c1
Sequence:CCGGCCAACATTGACAAGAAGTTCTCTCGAGAGAACTTCTTGTCAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-734s21c1
Sequence:CCGGGCGGACAGTCAAGATGAGAAACTCGAGTTTCTCATCTTGACTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-1025s21c1
Sequence:CCGGGAGCTGGTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTACCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-791s21c1
Sequence:CCGGCGAGATCCTTCGGAAAGACTTCTCGAGAAGTCTTTCCGAAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-674s21c1
Sequence:CCGGGAAGATCAAGAGTGAGGAGATCTCGAGATCTCCTCACTCTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-651s1c1
Sequence:CCGGGAAGATCAAGAGTGAGGAGATCTCGAGATCTCCTCACTCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-768s1c1
Sequence:CCGGCGAGATCCTTCGGAAAGACTTCTCGAGAAGTCTTTCCGAAGGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-276s1c1
Sequence:CCGGCGTGACCCTGAATGACATGAACTCGAGTTCATGTCATTCAGGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004699.1-282s1c1
Sequence:CCGGCCTGAATGACATGAAGGCCAACTCGAGTTGGCCTTCATGTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-774s1c1
Sequence:CCGGCCTTCGGAAAGACTTCAGTGACTCGAGTCACTGAAGTCTTTCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-711s1c1
Sequence:CCGGGCGGACAGTCAAGATGAGAAACTCGAGTTTCTCATCTTGACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-562s1c1
Sequence:CCGGGACACAAGCTTCTTGCCTGATCTCGAGATCAGGCAAGAAGCTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004699.1-1068s1c1
Sequence:CCGGGAAGTGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-1002s1c1
Sequence:CCGGGAGCTGGTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTACCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-181s1c1
Sequence:CCGGGCGGAGGAGAACATCATGAAACTCGAGTTTCATGATGTTCTCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-203s1c1
Sequence:CCGGCCAACATTGACAAGAAGTTCTCTCGAGAGAACTTCTTGTCAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004699
VALIDATED
FAM50A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 50, member A
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-226s21c1
Sequence:CCGGCCAACATTGACAAGAAGTTCTCTCGAGAGAACTTCTTGTCAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-734s21c1
Sequence:CCGGGCGGACAGTCAAGATGAGAAACTCGAGTTTCTCATCTTGACTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-1025s21c1
Sequence:CCGGGAGCTGGTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTACCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-791s21c1
Sequence:CCGGCGAGATCCTTCGGAAAGACTTCTCGAGAAGTCTTTCCGAAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-674s21c1
Sequence:CCGGGAAGATCAAGAGTGAGGAGATCTCGAGATCTCCTCACTCTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-651s1c1
Sequence:CCGGGAAGATCAAGAGTGAGGAGATCTCGAGATCTCCTCACTCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-768s1c1
Sequence:CCGGCGAGATCCTTCGGAAAGACTTCTCGAGAAGTCTTTCCGAAGGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-276s1c1
Sequence:CCGGCGTGACCCTGAATGACATGAACTCGAGTTCATGTCATTCAGGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004699.1-282s1c1
Sequence:CCGGCCTGAATGACATGAAGGCCAACTCGAGTTGGCCTTCATGTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-774s1c1
Sequence:CCGGCCTTCGGAAAGACTTCAGTGACTCGAGTCACTGAAGTCTTTCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-711s1c1
Sequence:CCGGGCGGACAGTCAAGATGAGAAACTCGAGTTTCTCATCTTGACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-562s1c1
Sequence:CCGGGACACAAGCTTCTTGCCTGATCTCGAGATCAGGCAAGAAGCTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004699.1-1068s1c1
Sequence:CCGGGAAGTGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-1002s1c1
Sequence:CCGGGAGCTGGTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTACCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-181s1c1
Sequence:CCGGGCGGAGGAGAACATCATGAAACTCGAGTTTCATGATGTTCTCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-203s1c1
Sequence:CCGGCCAACATTGACAAGAAGTTCTCTCGAGAGAACTTCTTGTCAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004699
VALIDATED
FAM50A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 50, member A
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-226s21c1
Sequence:CCGGCCAACATTGACAAGAAGTTCTCTCGAGAGAACTTCTTGTCAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-734s21c1
Sequence:CCGGGCGGACAGTCAAGATGAGAAACTCGAGTTTCTCATCTTGACTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-1025s21c1
Sequence:CCGGGAGCTGGTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTACCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-791s21c1
Sequence:CCGGCGAGATCCTTCGGAAAGACTTCTCGAGAAGTCTTTCCGAAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004699.2-674s21c1
Sequence:CCGGGAAGATCAAGAGTGAGGAGATCTCGAGATCTCCTCACTCTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-651s1c1
Sequence:CCGGGAAGATCAAGAGTGAGGAGATCTCGAGATCTCCTCACTCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-768s1c1
Sequence:CCGGCGAGATCCTTCGGAAAGACTTCTCGAGAAGTCTTTCCGAAGGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-276s1c1
Sequence:CCGGCGTGACCCTGAATGACATGAACTCGAGTTCATGTCATTCAGGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004699.1-282s1c1
Sequence:CCGGCCTGAATGACATGAAGGCCAACTCGAGTTGGCCTTCATGTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-774s1c1
Sequence:CCGGCCTTCGGAAAGACTTCAGTGACTCGAGTCACTGAAGTCTTTCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-711s1c1
Sequence:CCGGGCGGACAGTCAAGATGAGAAACTCGAGTTTCTCATCTTGACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-562s1c1
Sequence:CCGGGACACAAGCTTCTTGCCTGATCTCGAGATCAGGCAAGAAGCTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004699.1-1068s1c1
Sequence:CCGGGAAGTGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004699.1-1002s1c1
Sequence:CCGGGAGCTGGTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTACCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-181s1c1
Sequence:CCGGGCGGAGGAGAACATCATGAAACTCGAGTTTCATGATGTTCTCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004699.1-203s1c1
Sequence:CCGGCCAACATTGACAAGAAGTTCTCTCGAGAGAACTTCTTGTCAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138607
VALIDATED
FAM50A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 50, member A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-617s21c1
Sequence:CCGGGAGGGAAGAGATCACCACAAACTCGAGTTTGTGGTGATCTCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.2-283s1c1
Sequence:CCGGGGATTGCAGAGGAGAACATAACTCGAGTTATGTTCTCCTCTGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-929s21c1
Sequence:CCGGCATGTACATCAAGGAGGATTTCTCGAGAAATCCTCCTTGATGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-1068s21c1
Sequence:CCGGGTGGAGAAGGATGAGTCACATCTCGAGATGTGACTCATCCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-1175s21c1
Sequence:CCGGGAAATGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-1069s1c1
Sequence:CCGGGTGGAGAAGGATGAGTCACATCTCGAGATGTGACTCATCCTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-618s1c1
Sequence:CCGGGAGGGAAGAGATCACCACAAACTCGAGTTTGTGGTGATCTCTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-1176s1c1
Sequence:CCGGGAAATGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-930s1c1
Sequence:CCGGCATGTACATCAAGGAGGATTTCTCGAGAAATCCTCCTTGATGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.1-772s1c1
Sequence:CCGGGAAGAGATTGAAATCACCTTTCTCGAGAAAGGTGATTTCAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138607.1-334s1c1
Sequence:CCGGGCACACTATGATGCTGTGGAACTCGAGTTCCACAGCATCATAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.1-622s1c1
Sequence:CCGGGAAGAGATCACCACAAAGAAACTCGAGTTTCTTTGTGGTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138607
VALIDATED
FAM50A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 50, member A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-617s21c1
Sequence:CCGGGAGGGAAGAGATCACCACAAACTCGAGTTTGTGGTGATCTCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.2-283s1c1
Sequence:CCGGGGATTGCAGAGGAGAACATAACTCGAGTTATGTTCTCCTCTGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-929s21c1
Sequence:CCGGCATGTACATCAAGGAGGATTTCTCGAGAAATCCTCCTTGATGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-1068s21c1
Sequence:CCGGGTGGAGAAGGATGAGTCACATCTCGAGATGTGACTCATCCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-1175s21c1
Sequence:CCGGGAAATGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-1069s1c1
Sequence:CCGGGTGGAGAAGGATGAGTCACATCTCGAGATGTGACTCATCCTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-618s1c1
Sequence:CCGGGAGGGAAGAGATCACCACAAACTCGAGTTTGTGGTGATCTCTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-1176s1c1
Sequence:CCGGGAAATGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-930s1c1
Sequence:CCGGCATGTACATCAAGGAGGATTTCTCGAGAAATCCTCCTTGATGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.1-772s1c1
Sequence:CCGGGAAGAGATTGAAATCACCTTTCTCGAGAAAGGTGATTTCAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138607.1-334s1c1
Sequence:CCGGGCACACTATGATGCTGTGGAACTCGAGTTCCACAGCATCATAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.1-622s1c1
Sequence:CCGGGAAGAGATCACCACAAAGAAACTCGAGTTTCTTTGTGGTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138607
VALIDATED
FAM50A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 50, member A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-617s21c1
Sequence:CCGGGAGGGAAGAGATCACCACAAACTCGAGTTTGTGGTGATCTCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.2-283s1c1
Sequence:CCGGGGATTGCAGAGGAGAACATAACTCGAGTTATGTTCTCCTCTGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-929s21c1
Sequence:CCGGCATGTACATCAAGGAGGATTTCTCGAGAAATCCTCCTTGATGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-1068s21c1
Sequence:CCGGGTGGAGAAGGATGAGTCACATCTCGAGATGTGACTCATCCTTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138607.2-1175s21c1
Sequence:CCGGGAAATGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-1069s1c1
Sequence:CCGGGTGGAGAAGGATGAGTCACATCTCGAGATGTGACTCATCCTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-618s1c1
Sequence:CCGGGAGGGAAGAGATCACCACAAACTCGAGTTTGTGGTGATCTCTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-1176s1c1
Sequence:CCGGGAAATGGGACAAGTACACGATCTCGAGATCGTGTACTTGTCCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138607.1-930s1c1
Sequence:CCGGCATGTACATCAAGGAGGATTTCTCGAGAAATCCTCCTTGATGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.1-772s1c1
Sequence:CCGGGAAGAGATTGAAATCACCTTTCTCGAGAAAGGTGATTTCAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138607.1-334s1c1
Sequence:CCGGGCACACTATGATGCTGTGGAACTCGAGTTCCACAGCATCATAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138607.1-622s1c1
Sequence:CCGGGAAGAGATCACCACAAAGAAACTCGAGTTTCTTTGTGGTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks