EMAIL THIS PAGE TO A FRIEND

FAM50B

family with sequence similarity 50, member B

41 Gene Product Result for
Synonyms: D6S2654E X5L
UniProtKB ID: Q9Y247, Q5T2L6
Gene ID:
Mouse(108161) family with sequence similarity 50, member B
Rat(306883) family with sequence similarity 50, member B
naked mole-rat(101723939) family with sequence similarity 50, member B
domestic guinea pig(100718021) family with sequence similarity 50, member B
domestic cat(101082821) family with sequence similarity 50, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041161 MISSION® esiRNA esiRNA human FAM50B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012135 Rosetta Predictions human pricing
NM_001107349 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343693 predicted 724
2 SASI_Hs02_00343694 predicted 661
3 SASI_Hs02_00343695 predicted 980
4 SASI_Hs01_00132175 predicted 839
5 SASI_Hs01_00132176 predicted 902
6 SASI_Hs01_00132177 predicted 854
7 SASI_Hs01_00132178 predicted 1157
8 SASI_Hs01_00132179 predicted 1146
9 SASI_Hs01_00132180 predicted 900
10 SASI_Hs01_00132181 predicted 888
11 SASI_Hs01_00132174 predicted 1092
12 SASI_Hs01_00132182 predicted 907
13 SASI_Hs01_00132183 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227945 predicted 1038
2 SASI_Rn02_00227946 predicted 336
3 SASI_Rn02_00227947 predicted 271
4 SASI_Rn02_00227948 predicted 788
5 SASI_Rn02_00227949 predicted 547
6 SASI_Rn02_00227950 predicted 339
7 SASI_Rn02_00227951 predicted 589
8 SASI_Rn02_00227952 predicted 498
9 SASI_Rn02_00227953 predicted 1058
10 SASI_Rn02_00227954 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012135
FAM50B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 50, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-1003s1c1
Sequence:CCGGGTACGAGAAGAACAAGCACATCTCGAGATGTGCTTGTTCTTCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012135.1-1417s1c1
Sequence:CCGGCCACAGTGACTGAGTTTGATTCTCGAGAATCAAACTCAGTCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-856s1c1
Sequence:CCGGCACCTTCTACGACTTCATCATCTCGAGATGATGAAGTCGTAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-1006s1c1
Sequence:CCGGCGAGAAGAACAAGCACATCTTCTCGAGAAGATGTGCTTGTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012135.1-1346s1c1
Sequence:CCGGCCCACTGTCAGACAGAAATTACTCGAGTAATTTCTGTCTGACAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012135
FAM50B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 50, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-1003s1c1
Sequence:CCGGGTACGAGAAGAACAAGCACATCTCGAGATGTGCTTGTTCTTCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012135.1-1417s1c1
Sequence:CCGGCCACAGTGACTGAGTTTGATTCTCGAGAATCAAACTCAGTCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-856s1c1
Sequence:CCGGCACCTTCTACGACTTCATCATCTCGAGATGATGAAGTCGTAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-1006s1c1
Sequence:CCGGCGAGAAGAACAAGCACATCTTCTCGAGAAGATGTGCTTGTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012135.1-1346s1c1
Sequence:CCGGCCCACTGTCAGACAGAAATTACTCGAGTAATTTCTGTCTGACAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012135
FAM50B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 50, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-1003s1c1
Sequence:CCGGGTACGAGAAGAACAAGCACATCTCGAGATGTGCTTGTTCTTCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012135.1-1417s1c1
Sequence:CCGGCCACAGTGACTGAGTTTGATTCTCGAGAATCAAACTCAGTCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-856s1c1
Sequence:CCGGCACCTTCTACGACTTCATCATCTCGAGATGATGAAGTCGTAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012135.1-1006s1c1
Sequence:CCGGCGAGAAGAACAAGCACATCTTCTCGAGAAGATGTGCTTGTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012135.1-1346s1c1
Sequence:CCGGCCCACTGTCAGACAGAAATTACTCGAGTAATTTCTGTCTGACAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138746
FAM50B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 50, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-678s21c1
Sequence:CCGGAGAAGAACTTGGGCAAGAATCCTCGAGGATTCTTGCCCAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-338s21c1
Sequence:CCGGATCGCAGAGGAGACCATCATGCTCGAGCATGATGGTCTCCTCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-1143s21c1
Sequence:CCGGTTCGCAGCTGGTACGAGAAGACTCGAGTCTTCTCGTACCAGCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-283s21c1
Sequence:CCGGCCTGATCAAGAAGCGTGAGAACTCGAGTTCTCACGCTTCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-984s21c1
Sequence:CCGGATCTCATCCTGCCGCACTATCCTCGAGGATAGTGCGGCAGGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138746
FAM50B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 50, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-678s21c1
Sequence:CCGGAGAAGAACTTGGGCAAGAATCCTCGAGGATTCTTGCCCAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-338s21c1
Sequence:CCGGATCGCAGAGGAGACCATCATGCTCGAGCATGATGGTCTCCTCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-1143s21c1
Sequence:CCGGTTCGCAGCTGGTACGAGAAGACTCGAGTCTTCTCGTACCAGCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-283s21c1
Sequence:CCGGCCTGATCAAGAAGCGTGAGAACTCGAGTTCTCACGCTTCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-984s21c1
Sequence:CCGGATCTCATCCTGCCGCACTATCCTCGAGGATAGTGCGGCAGGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138746
FAM50B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 50, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-678s21c1
Sequence:CCGGAGAAGAACTTGGGCAAGAATCCTCGAGGATTCTTGCCCAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-338s21c1
Sequence:CCGGATCGCAGAGGAGACCATCATGCTCGAGCATGATGGTCTCCTCTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-1143s21c1
Sequence:CCGGTTCGCAGCTGGTACGAGAAGACTCGAGTCTTCTCGTACCAGCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-283s21c1
Sequence:CCGGCCTGATCAAGAAGCGTGAGAACTCGAGTTCTCACGCTTCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138746.2-984s21c1
Sequence:CCGGATCTCATCCTGCCGCACTATCCTCGAGGATAGTGCGGCAGGATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks