EMAIL THIS PAGE TO A FRIEND

FAM53A

family with sequence similarity 53, member A

87 Gene Product Result for
Synonyms: DNTNP
UniProtKB ID: Q6NSI3, Q6ZUL5
Gene ID:
Mouse(74504) family with sequence similarity 53, member A
Rat(305461) family with sequence similarity 53, member A
chicken(378905) family with sequence similarity 53, member A
dog(610722) family with sequence similarity 53, member A
naked mole-rat(101716944) family with sequence similarity 53, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013622 Rosetta Predictions human pricing
NM_001107228 Rosetta Predictions rat pricing
NM_178390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049295 predicted 1251
2 SASI_Hs01_00049296 predicted 551
3 SASI_Hs01_00049297 predicted 1566
4 SASI_Hs01_00049298 predicted 1752
5 SASI_Hs02_00306391 predicted 272
6 SASI_Hs02_00306392 predicted 979
7 SASI_Hs02_00306393 predicted 1890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226775 predicted 756
2 SASI_Rn02_00226776 predicted 1105
3 SASI_Rn02_00226777 predicted 771
4 SASI_Rn02_00226778 predicted 902
5 SASI_Rn02_00226779 predicted 1609
6 SASI_Rn02_00226780 predicted 755
7 SASI_Rn02_00226781 predicted 1780
8 SASI_Rn02_00226782 predicted 728
9 SASI_Rn02_00226783 predicted 1379
10 SASI_Rn02_00226784 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024146 predicted 563
2 SASI_Mm01_00024147 predicted 737
3 SASI_Mm02_00348800 predicted 305
4 SASI_Mm01_00024148 predicted 360
5 SASI_Mm01_00024149 predicted 976
6 SASI_Mm01_00024150 predicted 689
7 SASI_Mm01_00024151 predicted 799
8 SASI_Mm01_00024152 predicted 397
9 SASI_Mm01_00024153 predicted 1312
10 SASI_Mm01_00024154 predicted 970
11 SASI_Mm01_00024155 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013622
FAM53A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 53, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013622.2-297s21c1
Sequence:CCGGGAACAAGAGCGGTCGTCTGTTCTCGAGAACAGACGACCGCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013622.2-1629s21c1
Sequence:CCGGAGGGCACAGAGTAGGTTTCCTCTCGAGAGGAAACCTACTCTGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013622.2-1815s21c1
Sequence:CCGGGGGCACAGACTAGGTTTCATGCTCGAGCATGAAACCTAGTCTGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013622.2-434s21c1
Sequence:CCGGCTCACACCATGGGTCTTCAGTCTCGAGACTGAAGACCCATGGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013622.1-1111s1c1
Sequence:CCGGCTCAATTACGAAGATGACGATCTCGAGATCGTCATCTTCGTAATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013622.1-2184s1c1
Sequence:CCGGGCACAGAGTAGGTTTCGTGTTCTCGAGAACACGAAACCTACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013622.1-2205s1c1
Sequence:CCGGGCTTGGAACATTAAGGCGTAACTCGAGTTACGCCTTAATGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013622
FAM53A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 53, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013622.2-297s21c1
Sequence:CCGGGAACAAGAGCGGTCGTCTGTTCTCGAGAACAGACGACCGCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013622.2-1629s21c1
Sequence:CCGGAGGGCACAGAGTAGGTTTCCTCTCGAGAGGAAACCTACTCTGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013622.2-1815s21c1
Sequence:CCGGGGGCACAGACTAGGTTTCATGCTCGAGCATGAAACCTAGTCTGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013622.2-434s21c1
Sequence:CCGGCTCACACCATGGGTCTTCAGTCTCGAGACTGAAGACCCATGGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013622.1-1111s1c1
Sequence:CCGGCTCAATTACGAAGATGACGATCTCGAGATCGTCATCTTCGTAATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013622.1-2184s1c1
Sequence:CCGGGCACAGAGTAGGTTTCGTGTTCTCGAGAACACGAAACCTACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013622.1-2205s1c1
Sequence:CCGGGCTTGGAACATTAAGGCGTAACTCGAGTTACGCCTTAATGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013622
FAM53A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 53, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013622.2-297s21c1
Sequence:CCGGGAACAAGAGCGGTCGTCTGTTCTCGAGAACAGACGACCGCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013622.2-1629s21c1
Sequence:CCGGAGGGCACAGAGTAGGTTTCCTCTCGAGAGGAAACCTACTCTGTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013622.2-1815s21c1
Sequence:CCGGGGGCACAGACTAGGTTTCATGCTCGAGCATGAAACCTAGTCTGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013622.2-434s21c1
Sequence:CCGGCTCACACCATGGGTCTTCAGTCTCGAGACTGAAGACCCATGGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013622.1-1111s1c1
Sequence:CCGGCTCAATTACGAAGATGACGATCTCGAGATCGTCATCTTCGTAATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013622.1-2184s1c1
Sequence:CCGGGCACAGAGTAGGTTTCGTGTTCTCGAGAACACGAAACCTACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013622.1-2205s1c1
Sequence:CCGGGCTTGGAACATTAAGGCGTAACTCGAGTTACGCCTTAATGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178390
VALIDATED
FAM53A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 53, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-983s1c1
Sequence:CCGGCTCTCACAAGAGCACCTTGTACTCGAGTACAAGGTGCTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1225s1c1
Sequence:CCGGCCTGGACTATGAAGACGATGACTCGAGTCATCGTCTTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-325s1c1
Sequence:CCGGGCAGAACCAGAGTTTGGATGACTCGAGTCATCCAAACTCTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1166s1c1
Sequence:CCGGCCGTCCTTGGACTTTCTGAAACTCGAGTTTCAGAAAGTCCAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1554s1c1
Sequence:CCGGCCTGACCAGTGGAAATAACTTCTCGAGAAGTTATTTCCACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178390
VALIDATED
FAM53A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 53, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-983s1c1
Sequence:CCGGCTCTCACAAGAGCACCTTGTACTCGAGTACAAGGTGCTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1225s1c1
Sequence:CCGGCCTGGACTATGAAGACGATGACTCGAGTCATCGTCTTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-325s1c1
Sequence:CCGGGCAGAACCAGAGTTTGGATGACTCGAGTCATCCAAACTCTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1166s1c1
Sequence:CCGGCCGTCCTTGGACTTTCTGAAACTCGAGTTTCAGAAAGTCCAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1554s1c1
Sequence:CCGGCCTGACCAGTGGAAATAACTTCTCGAGAAGTTATTTCCACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178390
VALIDATED
FAM53A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 53, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-983s1c1
Sequence:CCGGCTCTCACAAGAGCACCTTGTACTCGAGTACAAGGTGCTCTTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1225s1c1
Sequence:CCGGCCTGGACTATGAAGACGATGACTCGAGTCATCGTCTTCATAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-325s1c1
Sequence:CCGGGCAGAACCAGAGTTTGGATGACTCGAGTCATCCAAACTCTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1166s1c1
Sequence:CCGGCCGTCCTTGGACTTTCTGAAACTCGAGTTTCAGAAAGTCCAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178390.2-1554s1c1
Sequence:CCGGCCTGACCAGTGGAAATAACTTCTCGAGAAGTTATTTCCACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks