EMAIL THIS PAGE TO A FRIEND

FAM53B

family with sequence similarity 53, member B

125 Gene Product Result for
Synonyms: KIAA0140 RP11-12J10.2 bA12J10.2
UniProtKB ID: Q14153, D3DRF1, Q5VUW1, Q5VUW2, Q8N5S6
Gene ID:
Mouse(77938) family with sequence similarity 53, member B
Rat(309060) family with sequence similarity 53, member B
sheep(101104621) family with sequence similarity 53, member B
naked mole-rat(101724602) family with sequence similarity 53, member B
domestic guinea pig(100734965) family with sequence similarity 53, member B
Zebrafish(406586) family with sequence similarity 53, member B
chicken(768603) family with sequence similarity 53, member B
cow(534925) methyltransferase like 10
cow(615557) family with sequence similarity 53, member B
domestic cat(101100252) family with sequence similarity 53, member B
dog(611311) family with sequence similarity 53, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014661 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014661 Rosetta Predictions human pricing
NM_001107556 Rosetta Predictions rat pricing
NM_175268 Rosetta Predictions mouse pricing
NM_212473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193597 predicted 1339
2 SASI_Hs01_00193598 predicted 1755
3 SASI_Hs01_00193599 predicted 683
4 SASI_Hs01_00193600 predicted 1872
5 SASI_Hs01_00193601 predicted 868
6 SASI_Hs02_00346003 predicted 1236
7 SASI_Hs01_00193602 predicted 925
8 SASI_Hs01_00193603 predicted 599
9 SASI_Hs01_00193604 predicted 2091
10 SASI_Hs01_00193605 predicted 1759
11 SASI_Hs01_00193606 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229995 predicted 1498
2 SASI_Rn02_00229996 predicted 1886
3 SASI_Rn02_00229997 predicted 1280
4 SASI_Rn02_00229998 predicted 1812
5 SASI_Rn02_00229999 predicted 679
6 SASI_Rn02_00230000 predicted 665
7 SASI_Rn02_00230001 predicted 1929
8 SASI_Rn02_00230002 predicted 757
9 SASI_Rn02_00230003 predicted 1662
10 SASI_Rn02_00230004 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115455 predicted 1632
2 SASI_Mm01_00115456 predicted 341
3 SASI_Mm01_00115457 predicted 1346
4 SASI_Mm01_00115458 predicted 298
5 SASI_Mm01_00115459 predicted 589
6 SASI_Mm01_00115460 predicted 1369
7 SASI_Mm01_00115461 predicted 1477
8 SASI_Mm01_00115462 predicted 1712
9 SASI_Mm01_00115463 predicted 1659
10 SASI_Mm01_00115464 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171072 predicted 1694
2 SASI_Mm01_00171073 predicted 409
3 SASI_Mm01_00171074 predicted 1411
4 SASI_Mm01_00171075 predicted 356
5 SASI_Mm01_00171076 predicted 643
6 SASI_Mm01_00171077 predicted 1428
7 SASI_Mm01_00171078 predicted 1544
8 SASI_Mm01_00171079 predicted 1770
9 SASI_Mm01_00171080 predicted 1719
10 SASI_Mm01_00171081 predicted 1802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014661
FAM53B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 53, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014661.3-1340s1c1
Sequence:CCGGCTTAACGACAAGAAGGTCGGTCTCGAGACCGACCTTCTTGTCGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-1759s1c1
Sequence:CCGGCGAGTTGGACATTGAGCAGATCTCGAGATCTGCTCAATGTCCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-693s1c1
Sequence:CCGGCTCTTCAGATTGACCAACCGACTCGAGTCGGTTGGTCAATCTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-1333s1c1
Sequence:CCGGGTGTGTCCTTAACGACAAGAACTCGAGTTCTTGTCGTTAAGGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014661.3-3702s1c1
Sequence:CCGGCCATGTCTTCTTAGAGCAAATCTCGAGATTTGCTCTAAGAAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014661.3-4268s1c1
Sequence:CCGGGCTGGTTTCATGTTTGTGTTTCTCGAGAAACACAAACATGAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014661.3-1332s1c1
Sequence:CCGGCGTGTGTCCTTAACGACAAGACTCGAGTCTTGTCGTTAAGGACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-981s21c1
Sequence:CCGGAGCGCTATTCCAACGGCTTCACTCGAGTGAAGCCGTTGGAATAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014661.3-2055s21c1
Sequence:CCGGAGCTTTGAAGTTTGCGTCTTTCTCGAGAAAGACGCAAACTTCAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-787s21c1
Sequence:CCGGTGTGACCAGTCTGATCAAAGACTCGAGTCTTTGATCAGACTGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-871s21c1
Sequence:CCGGACTGTCCTTCTCCGATGAGATCTCGAGATCTCATCGGAGAAGGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-594s21c1
Sequence:CCGGGTGAACTGCACACGCCAAAGACTCGAGTCTTTGGCGTGTGCAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014661
FAM53B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 53, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014661.3-1340s1c1
Sequence:CCGGCTTAACGACAAGAAGGTCGGTCTCGAGACCGACCTTCTTGTCGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-1759s1c1
Sequence:CCGGCGAGTTGGACATTGAGCAGATCTCGAGATCTGCTCAATGTCCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-693s1c1
Sequence:CCGGCTCTTCAGATTGACCAACCGACTCGAGTCGGTTGGTCAATCTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-1333s1c1
Sequence:CCGGGTGTGTCCTTAACGACAAGAACTCGAGTTCTTGTCGTTAAGGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014661.3-3702s1c1
Sequence:CCGGCCATGTCTTCTTAGAGCAAATCTCGAGATTTGCTCTAAGAAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014661.3-4268s1c1
Sequence:CCGGGCTGGTTTCATGTTTGTGTTTCTCGAGAAACACAAACATGAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014661.3-1332s1c1
Sequence:CCGGCGTGTGTCCTTAACGACAAGACTCGAGTCTTGTCGTTAAGGACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-981s21c1
Sequence:CCGGAGCGCTATTCCAACGGCTTCACTCGAGTGAAGCCGTTGGAATAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014661.3-2055s21c1
Sequence:CCGGAGCTTTGAAGTTTGCGTCTTTCTCGAGAAAGACGCAAACTTCAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-787s21c1
Sequence:CCGGTGTGACCAGTCTGATCAAAGACTCGAGTCTTTGATCAGACTGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-871s21c1
Sequence:CCGGACTGTCCTTCTCCGATGAGATCTCGAGATCTCATCGGAGAAGGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-594s21c1
Sequence:CCGGGTGAACTGCACACGCCAAAGACTCGAGTCTTTGGCGTGTGCAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014661
FAM53B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 53, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014661.3-1340s1c1
Sequence:CCGGCTTAACGACAAGAAGGTCGGTCTCGAGACCGACCTTCTTGTCGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-1759s1c1
Sequence:CCGGCGAGTTGGACATTGAGCAGATCTCGAGATCTGCTCAATGTCCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-693s1c1
Sequence:CCGGCTCTTCAGATTGACCAACCGACTCGAGTCGGTTGGTCAATCTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014661.3-1333s1c1
Sequence:CCGGGTGTGTCCTTAACGACAAGAACTCGAGTTCTTGTCGTTAAGGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014661.3-3702s1c1
Sequence:CCGGCCATGTCTTCTTAGAGCAAATCTCGAGATTTGCTCTAAGAAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014661.3-4268s1c1
Sequence:CCGGGCTGGTTTCATGTTTGTGTTTCTCGAGAAACACAAACATGAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014661.3-1332s1c1
Sequence:CCGGCGTGTGTCCTTAACGACAAGACTCGAGTCTTGTCGTTAAGGACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-981s21c1
Sequence:CCGGAGCGCTATTCCAACGGCTTCACTCGAGTGAAGCCGTTGGAATAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014661.3-2055s21c1
Sequence:CCGGAGCTTTGAAGTTTGCGTCTTTCTCGAGAAAGACGCAAACTTCAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-787s21c1
Sequence:CCGGTGTGACCAGTCTGATCAAAGACTCGAGTCTTTGATCAGACTGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-871s21c1
Sequence:CCGGACTGTCCTTCTCCGATGAGATCTCGAGATCTCATCGGAGAAGGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014661.3-594s21c1
Sequence:CCGGGTGAACTGCACACGCCAAAGACTCGAGTCTTTGGCGTGTGCAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175268
FAM53B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 53, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175268.4-2076s21c1
Sequence:CCGGGACCAGAAGCCATCCATATTGCTCGAGCAATATGGATGGCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-348s21c1
Sequence:CCGGCCTCCTTTCCTGTGGAATTATCTCGAGATAATTCCACAGGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-1046s21c1
Sequence:CCGGCTCAGCCCTGTGTCCTTAATGCTCGAGCATTAAGGACACAGGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-1450s21c1
Sequence:CCGGACGAACAGCCTCTGCTCTTTGCTCGAGCAAAGAGCAGAGGCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175268
FAM53B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 53, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175268.4-2076s21c1
Sequence:CCGGGACCAGAAGCCATCCATATTGCTCGAGCAATATGGATGGCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-348s21c1
Sequence:CCGGCCTCCTTTCCTGTGGAATTATCTCGAGATAATTCCACAGGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-1046s21c1
Sequence:CCGGCTCAGCCCTGTGTCCTTAATGCTCGAGCATTAAGGACACAGGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-1450s21c1
Sequence:CCGGACGAACAGCCTCTGCTCTTTGCTCGAGCAAAGAGCAGAGGCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175268
FAM53B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 53, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175268.4-2076s21c1
Sequence:CCGGGACCAGAAGCCATCCATATTGCTCGAGCAATATGGATGGCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-348s21c1
Sequence:CCGGCCTCCTTTCCTGTGGAATTATCTCGAGATAATTCCACAGGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-1046s21c1
Sequence:CCGGCTCAGCCCTGTGTCCTTAATGCTCGAGCATTAAGGACACAGGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175268.4-1450s21c1
Sequence:CCGGACGAACAGCCTCTGCTCTTTGCTCGAGCAAAGAGCAGAGGCTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks