EMAIL THIS PAGE TO A FRIEND

FAM53C

family with sequence similarity 53, member C

Synonyms: C5orf6
UniProtKB ID: Q9NYF3, B2RDJ5, D3DQB9
Gene ID:
Mouse(66306) family with sequence similarity 53, member C
Rat(685405) family with sequence similarity 53, member C
cow(534006) family with sequence similarity 53, member C
domestic cat(101087444) family with sequence similarity 53, member C
dog(608692) family with sequence similarity 53, member C
domestic guinea pig(100735866) family with sequence similarity 53, member C
naked mole-rat(101713298) family with sequence similarity 53, member C
sheep(101111018) family with sequence similarity 53, member C
223 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031431 MISSION® esiRNA esiRNA human FAM53C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016605 Rosetta Predictions human pricing
XM_001062805 Rosetta Predictions rat pricing
XM_001062862 Rosetta Predictions rat pricing
NM_175104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147742 predicted 1842
2 SASI_Hs01_00147743 predicted 1582
3 SASI_Hs01_00147744 predicted 1523
4 SASI_Hs01_00147745 predicted 1335
5 SASI_Hs01_00147746 predicted 1828
6 SASI_Hs01_00147747 predicted 1777
7 SASI_Hs02_00349742 predicted 1801
8 SASI_Hs01_00147748 predicted 1151
9 SASI_Hs01_00147749 predicted 1395
10 SASI_Hs01_00147750 predicted 235
11 SASI_Hs01_00147751 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304677 predicted 1698
2 SASI_Rn02_00304678 predicted 582
3 SASI_Rn02_00304679 predicted 474
4 SASI_Rn02_00304680 predicted 488
5 SASI_Rn02_00304681 predicted 920
6 SASI_Rn02_00304682 predicted 1512
7 SASI_Rn02_00304683 predicted 566
8 SASI_Rn02_00304684 predicted 987
9 SASI_Rn02_00304685 predicted 992
10 SASI_Rn02_00304686 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304857 predicted 1481
2 SASI_Rn02_00304858 predicted 359
3 SASI_Rn02_00304859 predicted 259
4 SASI_Rn02_00304860 predicted 267
5 SASI_Rn02_00304861 predicted 702
6 SASI_Rn02_00304862 predicted 1293
7 SASI_Rn02_00304863 predicted 346
8 SASI_Rn02_00304864 predicted 770
9 SASI_Rn02_00304865 predicted 775
10 SASI_Rn02_00304866 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052097 predicted 1694
2 SASI_Mm01_00052098 predicted 1493
3 SASI_Mm01_00052100 predicted 1437
4 SASI_Mm01_00052101 predicted 1580
5 SASI_Mm01_00052103 predicted 591
6 SASI_Mm02_00345703 predicted 1280
7 SASI_Mm01_00052104 predicted 1677
8 SASI_Mm01_00052105 predicted 592
9 SASI_Mm01_00052106 predicted 1374
10 SASI_Mm02_00345704 predicted 1325
11 SASI_Mm01_00052099 predicted 511
12 SASI_Mm01_00052102 predicted 1330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016605
VALIDATED
FAM53C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 53, member C
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-496s21c1
Sequence:CCGGGAAATGCACACGCTTCAGCATCTCGAGATGCTGAAGCGTGTGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-1354s21c1
Sequence:CCGGCAAGATGAATCAGAAACCATACTCGAGTATGGTTTCTGATTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016605.2-3930s21c1
Sequence:CCGGGCAGCCTATGATTGCTTCTTTCTCGAGAAAGAAGCAATCATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-862s21c1
Sequence:CCGGCAAGCTGTGGACTCCCATAAACTCGAGTTTATGGGAGTCCACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-1337s21c1
Sequence:CCGGCCTTCGTTGGACTTTGACAAGCTCGAGCTTGTCAAAGTCCAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-3668s1c1
Sequence:CCGGGCAGCCTATGATTGCTTCTTTCTCGAGAAAGAAGCAATCATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-1072s1c1
Sequence:CCGGGCCTTCGTTGGACTTTGACAACTCGAGTTGTCAAAGTCCAACGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-1102s1c1
Sequence:CCGGGAAACCATACTCAGGAGGTCTCTCGAGAGACCTCCTGAGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-215s1c1
Sequence:CCGGCAGACTCTGGATGAGCTGAAACTCGAGTTTCAGCTCATCCAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-1073s1c1
Sequence:CCGGCCTTCGTTGGACTTTGACAAGCTCGAGCTTGTCAAAGTCCAACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-232s1c1
Sequence:CCGGGAAATGCACACGCTTCAGCATCTCGAGATGCTGAAGCGTGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-1090s1c1
Sequence:CCGGCAAGATGAATCAGAAACCATACTCGAGTATGGTTTCTGATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016605.1-1334s1c1
Sequence:CCGGGACTTGAATTTGATTGAGGAACTCGAGTTCCTCAATCAAATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016605
VALIDATED
FAM53C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 53, member C
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-496s21c1
Sequence:CCGGGAAATGCACACGCTTCAGCATCTCGAGATGCTGAAGCGTGTGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-1354s21c1
Sequence:CCGGCAAGATGAATCAGAAACCATACTCGAGTATGGTTTCTGATTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016605.2-3930s21c1
Sequence:CCGGGCAGCCTATGATTGCTTCTTTCTCGAGAAAGAAGCAATCATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-862s21c1
Sequence:CCGGCAAGCTGTGGACTCCCATAAACTCGAGTTTATGGGAGTCCACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-1337s21c1
Sequence:CCGGCCTTCGTTGGACTTTGACAAGCTCGAGCTTGTCAAAGTCCAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-3668s1c1
Sequence:CCGGGCAGCCTATGATTGCTTCTTTCTCGAGAAAGAAGCAATCATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-1072s1c1
Sequence:CCGGGCCTTCGTTGGACTTTGACAACTCGAGTTGTCAAAGTCCAACGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-1102s1c1
Sequence:CCGGGAAACCATACTCAGGAGGTCTCTCGAGAGACCTCCTGAGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-215s1c1
Sequence:CCGGCAGACTCTGGATGAGCTGAAACTCGAGTTTCAGCTCATCCAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-1073s1c1
Sequence:CCGGCCTTCGTTGGACTTTGACAAGCTCGAGCTTGTCAAAGTCCAACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-232s1c1
Sequence:CCGGGAAATGCACACGCTTCAGCATCTCGAGATGCTGAAGCGTGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-1090s1c1
Sequence:CCGGCAAGATGAATCAGAAACCATACTCGAGTATGGTTTCTGATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016605.1-1334s1c1
Sequence:CCGGGACTTGAATTTGATTGAGGAACTCGAGTTCCTCAATCAAATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016605
VALIDATED
FAM53C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 53, member C
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-496s21c1
Sequence:CCGGGAAATGCACACGCTTCAGCATCTCGAGATGCTGAAGCGTGTGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-1354s21c1
Sequence:CCGGCAAGATGAATCAGAAACCATACTCGAGTATGGTTTCTGATTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016605.2-3930s21c1
Sequence:CCGGGCAGCCTATGATTGCTTCTTTCTCGAGAAAGAAGCAATCATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-862s21c1
Sequence:CCGGCAAGCTGTGGACTCCCATAAACTCGAGTTTATGGGAGTCCACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016605.2-1337s21c1
Sequence:CCGGCCTTCGTTGGACTTTGACAAGCTCGAGCTTGTCAAAGTCCAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-3668s1c1
Sequence:CCGGGCAGCCTATGATTGCTTCTTTCTCGAGAAAGAAGCAATCATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-1072s1c1
Sequence:CCGGGCCTTCGTTGGACTTTGACAACTCGAGTTGTCAAAGTCCAACGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-1102s1c1
Sequence:CCGGGAAACCATACTCAGGAGGTCTCTCGAGAGACCTCCTGAGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016605.1-215s1c1
Sequence:CCGGCAGACTCTGGATGAGCTGAAACTCGAGTTTCAGCTCATCCAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-1073s1c1
Sequence:CCGGCCTTCGTTGGACTTTGACAAGCTCGAGCTTGTCAAAGTCCAACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-232s1c1
Sequence:CCGGGAAATGCACACGCTTCAGCATCTCGAGATGCTGAAGCGTGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016605.1-1090s1c1
Sequence:CCGGCAAGATGAATCAGAAACCATACTCGAGTATGGTTTCTGATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016605.1-1334s1c1
Sequence:CCGGGACTTGAATTTGATTGAGGAACTCGAGTTCCTCAATCAAATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175104
FAM53C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 53, member C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175104.4-2471s1c1
Sequence:CCGGCCACTAGATGAATCTAGTATTCTCGAGAATACTAGATTCATCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-509s1c1
Sequence:CCGGCCTTTCCAGCTTGTGTCTGAACTCGAGTTCAGACACAAGCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175104.3-4010s1c1
Sequence:CCGGGCAGCCTATGTTTGCTTCTTTCTCGAGAAAGAAGCAAACATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1294s1c2
Sequence:CCGGCTTTGACAAGATGAATCAGAACTCGAGTTCTGATTCATCTTGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175104.3-1544s1c1
Sequence:CCGGCTGGACCTGAATCTGATTGAACTCGAGTTCAATCAGATTCAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1340s1c1
Sequence:CCGGCAAGAAACAGCCCGAGAAGAACTCGAGTTCTTCTCGGGCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1282s1c1
Sequence:CCGGGCCTTCCTTGGACTTTGACAACTCGAGTTGTCAAAGTCCAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175104
FAM53C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 53, member C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175104.4-2471s1c1
Sequence:CCGGCCACTAGATGAATCTAGTATTCTCGAGAATACTAGATTCATCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-509s1c1
Sequence:CCGGCCTTTCCAGCTTGTGTCTGAACTCGAGTTCAGACACAAGCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175104.3-4010s1c1
Sequence:CCGGGCAGCCTATGTTTGCTTCTTTCTCGAGAAAGAAGCAAACATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1294s1c2
Sequence:CCGGCTTTGACAAGATGAATCAGAACTCGAGTTCTGATTCATCTTGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175104.3-1544s1c1
Sequence:CCGGCTGGACCTGAATCTGATTGAACTCGAGTTCAATCAGATTCAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1340s1c1
Sequence:CCGGCAAGAAACAGCCCGAGAAGAACTCGAGTTCTTCTCGGGCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1282s1c1
Sequence:CCGGGCCTTCCTTGGACTTTGACAACTCGAGTTGTCAAAGTCCAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175104
FAM53C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 53, member C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175104.4-2471s1c1
Sequence:CCGGCCACTAGATGAATCTAGTATTCTCGAGAATACTAGATTCATCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-509s1c1
Sequence:CCGGCCTTTCCAGCTTGTGTCTGAACTCGAGTTCAGACACAAGCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175104.3-4010s1c1
Sequence:CCGGGCAGCCTATGTTTGCTTCTTTCTCGAGAAAGAAGCAAACATAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1294s1c2
Sequence:CCGGCTTTGACAAGATGAATCAGAACTCGAGTTCTGATTCATCTTGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175104.3-1544s1c1
Sequence:CCGGCTGGACCTGAATCTGATTGAACTCGAGTTCAATCAGATTCAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1340s1c1
Sequence:CCGGCAAGAAACAGCCCGAGAAGAACTCGAGTTCTTCTCGGGCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175104.3-1282s1c1
Sequence:CCGGGCCTTCCTTGGACTTTGACAACTCGAGTTGTCAAAGTCCAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks