EMAIL THIS PAGE TO A FRIEND

FAM57A

family with sequence similarity 57, member A

40 Gene Product Result for
Synonyms: CT120
UniProtKB ID: Q8TBR7, A8K7Q0, Q7Z464, Q96D97, Q9H6H3
Gene ID:
Mouse(116972) family with sequence similarity 57, member A
Rat(100360533) family with sequence similarity 57, member A
domestic guinea pig(100720145) family with sequence similarity 57, member A
naked mole-rat(101713167) family with sequence similarity 57, member A
sheep(101114371) family with sequence similarity 57, member A
chicken(427836) family with sequence similarity 57, member A
domestic cat(101088125) family with sequence similarity 57, member A
cow(508425) family with sequence similarity 57, member A
dog(480642) family with sequence similarity 57, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301609 ANTI-FA57A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024792 Rosetta Predictions human pricing
NM_027773 Rosetta Predictions mouse pricing
XM_282971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135914 predicted 1247
2 SASI_Hs01_00135915 predicted 893
3 SASI_Hs01_00135916 predicted 258
4 SASI_Hs01_00135917 predicted 404
5 SASI_Hs01_00135918 predicted 658
6 SASI_Hs02_00357342 predicted 802
7 SASI_Hs01_00135919 predicted 1264
8 SASI_Hs01_00135921 predicted 1286
9 SASI_Hs01_00135922 predicted 1003
10 SASI_Hs01_00135923 predicted 382
11 SASI_Hs01_00135920 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332719 predicted 385
2 SASI_Mm02_00332720 predicted 698
3 SASI_Mm02_00332721 predicted 709
4 SASI_Mm02_00332722 predicted 403
5 SASI_Mm02_00332723 predicted 428
6 SASI_Mm02_00332724 predicted 451
7 SASI_Mm02_00332725 predicted 433
8 SASI_Mm02_00332726 predicted 479
9 SASI_Mm02_00332727 predicted 672
10 SASI_Mm02_00332728 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_282971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272758 predicted 818
2 SASI_Mm01_00272759 predicted 545
3 SASI_Mm01_00272760 predicted 1394
4 SASI_Mm01_00272761 predicted 1327
5 SASI_Mm01_00272762 predicted 555
6 SASI_Mm01_00272763 predicted 1319
7 SASI_Mm01_00272764 predicted 1366
8 SASI_Mm01_00272765 predicted 1155
9 SASI_Mm01_00272766 predicted 600
10 SASI_Mm01_00272767 predicted 1416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024792
VALIDATED
FAM57A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 57, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-401s1c1
Sequence:CCGGGATCACACATCATGCGGTCATCTCGAGATGACCGCATGATGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024792.1-898s1c1
Sequence:CCGGCCTCAGACTTTGGGTATTGATCTCGAGATCAATACCCAAAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024792.1-1730s1c1
Sequence:CCGGCCAAACCATGAAATGTGTCATCTCGAGATGACACATTTCATGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-272s1c1
Sequence:CCGGGTGGTTTCTGATTCCATACATCTCGAGATGTATGGAATCAGAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-408s1c1
Sequence:CCGGCATCATGCGGTCATTCTCTTTCTCGAGAAAGAGAATGACCGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-272s21c1
Sequence:CCGGGTGGTTTCTGATTCCATACATCTCGAGATGTATGGAATCAGAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-1066s21c1
Sequence:CCGGGGATCCTTCTTAAGGTCTTATCTCGAGATAAGACCTTAAGAAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-530s21c1
Sequence:CCGGCAGGGTTCTGATTCAGCTAAACTCGAGTTTAGCTGAATCAGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-562s21c1
Sequence:CCGGCCCTTCTGTACAAGGTGAATGCTCGAGCATTCACCTTGTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024792.1-403s21c1
Sequence:CCGGTCACACATCATGCGGTCATTCCTCGAGGAATGACCGCATGATGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024792
VALIDATED
FAM57A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 57, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-401s1c1
Sequence:CCGGGATCACACATCATGCGGTCATCTCGAGATGACCGCATGATGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024792.1-898s1c1
Sequence:CCGGCCTCAGACTTTGGGTATTGATCTCGAGATCAATACCCAAAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024792.1-1730s1c1
Sequence:CCGGCCAAACCATGAAATGTGTCATCTCGAGATGACACATTTCATGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-272s1c1
Sequence:CCGGGTGGTTTCTGATTCCATACATCTCGAGATGTATGGAATCAGAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-408s1c1
Sequence:CCGGCATCATGCGGTCATTCTCTTTCTCGAGAAAGAGAATGACCGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-272s21c1
Sequence:CCGGGTGGTTTCTGATTCCATACATCTCGAGATGTATGGAATCAGAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-1066s21c1
Sequence:CCGGGGATCCTTCTTAAGGTCTTATCTCGAGATAAGACCTTAAGAAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-530s21c1
Sequence:CCGGCAGGGTTCTGATTCAGCTAAACTCGAGTTTAGCTGAATCAGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-562s21c1
Sequence:CCGGCCCTTCTGTACAAGGTGAATGCTCGAGCATTCACCTTGTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024792.1-403s21c1
Sequence:CCGGTCACACATCATGCGGTCATTCCTCGAGGAATGACCGCATGATGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024792
VALIDATED
FAM57A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 57, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-401s1c1
Sequence:CCGGGATCACACATCATGCGGTCATCTCGAGATGACCGCATGATGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024792.1-898s1c1
Sequence:CCGGCCTCAGACTTTGGGTATTGATCTCGAGATCAATACCCAAAGTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024792.1-1730s1c1
Sequence:CCGGCCAAACCATGAAATGTGTCATCTCGAGATGACACATTTCATGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-272s1c1
Sequence:CCGGGTGGTTTCTGATTCCATACATCTCGAGATGTATGGAATCAGAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024792.1-408s1c1
Sequence:CCGGCATCATGCGGTCATTCTCTTTCTCGAGAAAGAGAATGACCGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-272s21c1
Sequence:CCGGGTGGTTTCTGATTCCATACATCTCGAGATGTATGGAATCAGAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-1066s21c1
Sequence:CCGGGGATCCTTCTTAAGGTCTTATCTCGAGATAAGACCTTAAGAAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-530s21c1
Sequence:CCGGCAGGGTTCTGATTCAGCTAAACTCGAGTTTAGCTGAATCAGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024792.1-562s21c1
Sequence:CCGGCCCTTCTGTACAAGGTGAATGCTCGAGCATTCACCTTGTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024792.1-403s21c1
Sequence:CCGGTCACACATCATGCGGTCATTCCTCGAGGAATGACCGCATGATGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027773
VALIDATED
FAM57A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 57, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-709s21c1
Sequence:CCGGCTGCTCCAAGTGCCATTTAATCTCGAGATTAAATGGCACTTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-497s21c1
Sequence:CCGGGAGACCTTGGAGACTTCTTTGCTCGAGCAAAGAAGTCTCCAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-286s21c1
Sequence:CCGGCACTGGCTTGCCACAGAATATCTCGAGATATTCTGTGGCAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-555s21c1
Sequence:CCGGTGTGTCGCTGGCCAGAATAATCTCGAGATTATTCTGGCCAGCGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-461s21c1
Sequence:CCGGTGTTATTCCTTGTACCTATTTCTCGAGAAATAGGTACAAGGAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027773
VALIDATED
FAM57A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 57, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-709s21c1
Sequence:CCGGCTGCTCCAAGTGCCATTTAATCTCGAGATTAAATGGCACTTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-497s21c1
Sequence:CCGGGAGACCTTGGAGACTTCTTTGCTCGAGCAAAGAAGTCTCCAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-286s21c1
Sequence:CCGGCACTGGCTTGCCACAGAATATCTCGAGATATTCTGTGGCAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-555s21c1
Sequence:CCGGTGTGTCGCTGGCCAGAATAATCTCGAGATTATTCTGGCCAGCGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-461s21c1
Sequence:CCGGTGTTATTCCTTGTACCTATTTCTCGAGAAATAGGTACAAGGAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027773
VALIDATED
FAM57A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 57, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-709s21c1
Sequence:CCGGCTGCTCCAAGTGCCATTTAATCTCGAGATTAAATGGCACTTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-497s21c1
Sequence:CCGGGAGACCTTGGAGACTTCTTTGCTCGAGCAAAGAAGTCTCCAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-286s21c1
Sequence:CCGGCACTGGCTTGCCACAGAATATCTCGAGATATTCTGTGGCAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-555s21c1
Sequence:CCGGTGTGTCGCTGGCCAGAATAATCTCGAGATTATTCTGGCCAGCGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027773.3-461s21c1
Sequence:CCGGTGTTATTCCTTGTACCTATTTCTCGAGAAATAGGTACAAGGAATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks