EMAIL THIS PAGE TO A FRIEND

FAM57B

family with sequence similarity 57, member B

UniProtKB ID: Q71RH2, Q9H0J1
Gene ID:
Mouse(68952) family with sequence similarity 57, member B
Rat(293493) family with sequence similarity 57, member B
dog(489946) family with sequence similarity 57, member B
cow(785988) family with sequence similarity 57, member B
domestic cat(101100529) family with sequence similarity 57, member B
sheep(101123263) family with sequence similarity 57, member B
naked mole-rat(101703875) family with sequence similarity 57, member B
domestic guinea pig(100730676) family with sequence similarity 57, member B
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031478 Rosetta Predictions human pricing
NM_001106296 Rosetta Predictions rat pricing
XM_001480258 Rosetta Predictions mouse pricing
XM_924242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049824 predicted 570
2 SASI_Hs01_00049825 predicted 703
3 SASI_Hs01_00049826 predicted 1633
4 SASI_Hs01_00049828 predicted 585
5 SASI_Hs02_00358911 predicted 1635
6 SASI_Hs01_00049830 predicted 770
7 SASI_Hs01_00049831 predicted 846
8 SASI_Hs01_00049832 predicted 603
9 SASI_Hs01_00049833 predicted 550
10 SASI_Hs02_00358912 predicted 812
11 SASI_Hs01_00049827 predicted 246
12 SASI_Hs01_00049829 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217578 predicted 1421
2 SASI_Rn02_00217579 predicted 393
3 SASI_Rn02_00217580 predicted 524
4 SASI_Rn02_00217581 predicted 343
5 SASI_Rn02_00217582 predicted 1098
6 SASI_Rn02_00217583 predicted 401
7 SASI_Rn02_00217584 predicted 405
8 SASI_Rn02_00217585 predicted 839
9 SASI_Rn02_00217586 predicted 449
10 SASI_Rn02_00217587 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416234 predicted 804
2 SASI_Mm02_00416235 predicted 923
3 SASI_Mm02_00416236 predicted 779
4 SASI_Mm02_00416237 predicted 792
5 SASI_Mm02_00416238 predicted 820
6 SASI_Mm02_00416239 predicted 869
7 SASI_Mm02_00416240 predicted 1636
8 SASI_Mm02_00416241 predicted 891
9 SASI_Mm02_00416242 predicted 800
10 SASI_Mm02_00416243 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444109 predicted 236
2 SASI_Mm02_00444110 predicted 243
3 SASI_Mm02_00444111 predicted 579
4 SASI_Mm02_00444112 predicted 289
5 SASI_Mm02_00444113 predicted 447
6 SASI_Mm02_00444114 predicted 218
7 SASI_Mm02_00444115 predicted 477
8 SASI_Mm02_00444116 predicted 521
9 SASI_Mm02_00444117 predicted 460
10 SASI_Mm02_00444118 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026884
FAM57B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 57, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-528s21c1
Sequence:CCGGCTTCCTGCAAGCACATCATAGCTCGAGCTATGATGTGCTTGCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026884.1-1311s21c1
Sequence:CCGGAGAATAAGGAGAAGCTATATTCTCGAGAATATAGCTTCTCCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-797s21c1
Sequence:CCGGCGACAAGGCAAGGGAGATTTCCTCGAGGAAATCTCCCTTGCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-588s21c1
Sequence:CCGGCAGTTCCCTACTTCATCTATGCTCGAGCATAGATGAAGTAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-383s21c1
Sequence:CCGGCCACTGTGCTTTGTGGTATTACTCGAGTAATACCACAAAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026884
FAM57B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 57, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-528s21c1
Sequence:CCGGCTTCCTGCAAGCACATCATAGCTCGAGCTATGATGTGCTTGCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026884.1-1311s21c1
Sequence:CCGGAGAATAAGGAGAAGCTATATTCTCGAGAATATAGCTTCTCCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-797s21c1
Sequence:CCGGCGACAAGGCAAGGGAGATTTCCTCGAGGAAATCTCCCTTGCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-588s21c1
Sequence:CCGGCAGTTCCCTACTTCATCTATGCTCGAGCATAGATGAAGTAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-383s21c1
Sequence:CCGGCCACTGTGCTTTGTGGTATTACTCGAGTAATACCACAAAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026884
FAM57B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 57, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-528s21c1
Sequence:CCGGCTTCCTGCAAGCACATCATAGCTCGAGCTATGATGTGCTTGCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026884.1-1311s21c1
Sequence:CCGGAGAATAAGGAGAAGCTATATTCTCGAGAATATAGCTTCTCCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-797s21c1
Sequence:CCGGCGACAAGGCAAGGGAGATTTCCTCGAGGAAATCTCCCTTGCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-588s21c1
Sequence:CCGGCAGTTCCCTACTTCATCTATGCTCGAGCATAGATGAAGTAGGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026884.1-383s21c1
Sequence:CCGGCCACTGTGCTTTGTGGTATTACTCGAGTAATACCACAAAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031478
FAM57B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 57, member B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-254s1c1
Sequence:CCGGCATTGATGACCAACACTGGCTCTCGAGAGCCAGTGTTGGTCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-520s1c1
Sequence:CCGGGAGACTTCTTTCTGGGTTGCACTCGAGTGCAACCCAGAAAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1391s1c1
Sequence:CCGGCCAAATTTGAACTAGTCTGTTCTCGAGAACAGACTAGTTCAAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1356s1c1
Sequence:CCGGCAGCTTGAGGAATCTTATTTACTCGAGTAAATAAGATTCCTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1354s1c1
Sequence:CCGGGCCAGCTTGAGGAATCTTATTCTCGAGAATAAGATTCCTCAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-527s1c1
Sequence:CCGGCTTTCTGGGTTGCATGTTGATCTCGAGATCAACATGCAACCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-581s1c1
Sequence:CCGGCAAGATCCTCATCCAGTACAACTCGAGTTGTACTGGATGAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-290s1c1
Sequence:CCGGGCAATTTGCTGTGCCCTACTTCTCGAGAAGTAGGGCACAGCAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-311s1c1
Sequence:CCGGCATCTACGACATCTACGCCATCTCGAGATGGCGTAGATGTCGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-791s1c1
Sequence:CCGGGCTCTACTGGTTCTTCCTCATCTCGAGATGAGGAAGAACCAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-314s1c1
Sequence:CCGGCTACGACATCTACGCCATGTTCTCGAGAACATGGCGTAGATGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031478
FAM57B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 57, member B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-254s1c1
Sequence:CCGGCATTGATGACCAACACTGGCTCTCGAGAGCCAGTGTTGGTCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-520s1c1
Sequence:CCGGGAGACTTCTTTCTGGGTTGCACTCGAGTGCAACCCAGAAAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1391s1c1
Sequence:CCGGCCAAATTTGAACTAGTCTGTTCTCGAGAACAGACTAGTTCAAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1356s1c1
Sequence:CCGGCAGCTTGAGGAATCTTATTTACTCGAGTAAATAAGATTCCTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1354s1c1
Sequence:CCGGGCCAGCTTGAGGAATCTTATTCTCGAGAATAAGATTCCTCAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-527s1c1
Sequence:CCGGCTTTCTGGGTTGCATGTTGATCTCGAGATCAACATGCAACCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-581s1c1
Sequence:CCGGCAAGATCCTCATCCAGTACAACTCGAGTTGTACTGGATGAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-290s1c1
Sequence:CCGGGCAATTTGCTGTGCCCTACTTCTCGAGAAGTAGGGCACAGCAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-311s1c1
Sequence:CCGGCATCTACGACATCTACGCCATCTCGAGATGGCGTAGATGTCGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-791s1c1
Sequence:CCGGGCTCTACTGGTTCTTCCTCATCTCGAGATGAGGAAGAACCAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-314s1c1
Sequence:CCGGCTACGACATCTACGCCATGTTCTCGAGAACATGGCGTAGATGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031478
FAM57B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 57, member B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-254s1c1
Sequence:CCGGCATTGATGACCAACACTGGCTCTCGAGAGCCAGTGTTGGTCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-520s1c1
Sequence:CCGGGAGACTTCTTTCTGGGTTGCACTCGAGTGCAACCCAGAAAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1391s1c1
Sequence:CCGGCCAAATTTGAACTAGTCTGTTCTCGAGAACAGACTAGTTCAAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1356s1c1
Sequence:CCGGCAGCTTGAGGAATCTTATTTACTCGAGTAAATAAGATTCCTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031478.3-1354s1c1
Sequence:CCGGGCCAGCTTGAGGAATCTTATTCTCGAGAATAAGATTCCTCAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-527s1c1
Sequence:CCGGCTTTCTGGGTTGCATGTTGATCTCGAGATCAACATGCAACCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-581s1c1
Sequence:CCGGCAAGATCCTCATCCAGTACAACTCGAGTTGTACTGGATGAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-290s1c1
Sequence:CCGGGCAATTTGCTGTGCCCTACTTCTCGAGAAGTAGGGCACAGCAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-311s1c1
Sequence:CCGGCATCTACGACATCTACGCCATCTCGAGATGGCGTAGATGTCGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-791s1c1
Sequence:CCGGGCTCTACTGGTTCTTCCTCATCTCGAGATGAGGAAGAACCAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031478.3-314s1c1
Sequence:CCGGCTACGACATCTACGCCATGTTCTCGAGAACATGGCGTAGATGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks