EMAIL THIS PAGE TO A FRIEND

FAM58BP

family with sequence similarity 58, member B, pseudogene

Synonyms: FAM58B
Species: Human FAM58BP(339521)
UniProtKB ID: P0C7Q3
Gene ID:
8 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301958 ANTI-FAM58B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105517 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105517 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324154 predicted 704
2 SASI_Hs02_00324155 predicted 687
3 SASI_Hs02_00324156 predicted 698
4 SASI_Hs02_00324157 predicted 922
5 SASI_Hs02_00324158 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105517
FAM58BP MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 58, member B, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-752s21c1
Sequence:CCGGCTGATCTCATTCAGATTTATACTCGAGTATAAATCTGAATGAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-192s21c1
Sequence:CCGGTGCCACTGCTTGCACCATTTACTCGAGTAAATGGTGCAAGCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-262s21c1
Sequence:CCGGATTGCCATGTCTTCCATTTACCTCGAGGTAAATGGAAGACATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-309s21c1
Sequence:CCGGCCTGTGGGCTCATGACATCATCTCGAGATGATGTCATGAGCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-719s21c1
Sequence:CCGGACCTTACCAAGCCAATCATTGCTCGAGCAATGATTGGCTTGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105517
FAM58BP MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 58, member B, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-752s21c1
Sequence:CCGGCTGATCTCATTCAGATTTATACTCGAGTATAAATCTGAATGAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-192s21c1
Sequence:CCGGTGCCACTGCTTGCACCATTTACTCGAGTAAATGGTGCAAGCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-262s21c1
Sequence:CCGGATTGCCATGTCTTCCATTTACCTCGAGGTAAATGGAAGACATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-309s21c1
Sequence:CCGGCCTGTGGGCTCATGACATCATCTCGAGATGATGTCATGAGCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-719s21c1
Sequence:CCGGACCTTACCAAGCCAATCATTGCTCGAGCAATGATTGGCTTGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105517
FAM58BP MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 58, member B, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-752s21c1
Sequence:CCGGCTGATCTCATTCAGATTTATACTCGAGTATAAATCTGAATGAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-192s21c1
Sequence:CCGGTGCCACTGCTTGCACCATTTACTCGAGTAAATGGTGCAAGCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-262s21c1
Sequence:CCGGATTGCCATGTCTTCCATTTACCTCGAGGTAAATGGAAGACATGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-309s21c1
Sequence:CCGGCCTGTGGGCTCATGACATCATCTCGAGATGATGTCATGAGCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105517.1-719s21c1
Sequence:CCGGACCTTACCAAGCCAATCATTGCTCGAGCAATGATTGGCTTGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks