EMAIL THIS PAGE TO A FRIEND

FAM5C

family with sequence similarity 5, member C

79 Gene Product Result for
Synonyms: BRINP3 DBCCR1L DBCCR1L1
UniProtKB ID: Q76B58, B3KVP1, O95726, Q2M330
Gene ID:
Mouse(215378) family with sequence similarity 5, member C
Rat(286901) family with sequence similarity 5, member C
naked mole-rat(101703689) family with sequence similarity 5, member C
domestic guinea pig(100714872) family with sequence similarity 5, member C
sheep(101123479) family with sequence similarity 5, member C
chicken(429077) family with sequence similarity 5, member C
cow(531710) family with sequence similarity 5, member C
domestic cat(101089978) family with sequence similarity 5, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199051 Rosetta Predictions human pricing
NM_173121 Rosetta Predictions rat pricing
NM_153539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372540 predicted 2346
2 SASI_Hs01_00101798 predicted 2506
3 SASI_Hs01_00101799 predicted 1228
4 SASI_Hs01_00101800 predicted 1849
5 SASI_Hs01_00101802 predicted 2417
6 SASI_Hs01_00101804 predicted 890
7 SASI_Hs01_00101805 predicted 1744
8 SASI_Hs01_00101806 predicted 1013
9 SASI_Hs02_00372541 predicted 1249
10 SASI_Hs02_00372542 predicted 280
11 SASI_Hs01_00101797 predicted 1155
12 SASI_Hs01_00101801 predicted 1085
13 SASI_Hs01_00101803 predicted 2608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110602 predicted 2553
2 SASI_Rn01_00110603 predicted 2719
3 SASI_Rn01_00110604 predicted 2644
4 SASI_Rn01_00110606 predicted 2071
5 SASI_Rn01_00110607 predicted 968
6 SASI_Rn01_00110608 predicted 1878
7 SASI_Rn01_00110609 predicted 491
8 SASI_Rn01_00110610 predicted 1221
9 SASI_Rn02_00269279 predicted 815
10 SASI_Rn01_00110611 predicted 2348
11 SASI_Rn01_00110605 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022376 predicted 2548
2 SASI_Mm01_00022377 predicted 969
3 SASI_Mm01_00022378 predicted 497
4 SASI_Mm01_00022379 predicted 1231
5 SASI_Mm01_00022381 predicted 792
6 SASI_Mm01_00022382 predicted 1243
7 SASI_Mm01_00022383 predicted 1296
8 SASI_Mm02_00343305 predicted 1549
9 SASI_Mm01_00022384 predicted 1950
10 SASI_Mm01_00022385 predicted 2713
11 SASI_Mm01_00022380 predicted 1911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199051
FAM5C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 5, member C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-2144s1c1
Sequence:CCGGCCCAATGGTAATGAGAGCATTCTCGAGAATGCTCTCATTACCATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-1145s1c1
Sequence:CCGGCGAATAACTGAAACCTGGAAACTCGAGTTTCCAGGTTTCAGTTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152416    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199051.1-2675s1c1
Sequence:CCGGCACACATGAACTTGCTGACAACTCGAGTTGTCAGCAAGTTCATGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-1366s1c1
Sequence:CCGGCCTTAGCAAGAGGTGTCATAACTCGAGTTATGACACCTCTTGCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-436s1c1
Sequence:CCGGGCAGGGATTTAGCACAAGATACTCGAGTATCTTGTGCTAAATCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-806s1c1
Sequence:CCGGCTTCGGAGACTTCACCACATTCTCGAGAATGTGGTGAAGTCTCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-809s1c1
Sequence:CCGGCGGAGACTTCACCACATTCAACTCGAGTTGAATGTGGTGAAGTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-287s1c1
Sequence:CCGGGAGTGGATAGCACTGAGTCTTCTCGAGAAGACTCAGTGCTATCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-2264s1c1
Sequence:CCGGGAAGCAATTCGGGACCTGATTCTCGAGAATCAGGTCCCGAATTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199051
FAM5C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 5, member C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-2144s1c1
Sequence:CCGGCCCAATGGTAATGAGAGCATTCTCGAGAATGCTCTCATTACCATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-1145s1c1
Sequence:CCGGCGAATAACTGAAACCTGGAAACTCGAGTTTCCAGGTTTCAGTTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152416    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199051.1-2675s1c1
Sequence:CCGGCACACATGAACTTGCTGACAACTCGAGTTGTCAGCAAGTTCATGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-1366s1c1
Sequence:CCGGCCTTAGCAAGAGGTGTCATAACTCGAGTTATGACACCTCTTGCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-436s1c1
Sequence:CCGGGCAGGGATTTAGCACAAGATACTCGAGTATCTTGTGCTAAATCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-806s1c1
Sequence:CCGGCTTCGGAGACTTCACCACATTCTCGAGAATGTGGTGAAGTCTCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-809s1c1
Sequence:CCGGCGGAGACTTCACCACATTCAACTCGAGTTGAATGTGGTGAAGTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-287s1c1
Sequence:CCGGGAGTGGATAGCACTGAGTCTTCTCGAGAAGACTCAGTGCTATCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-2264s1c1
Sequence:CCGGGAAGCAATTCGGGACCTGATTCTCGAGAATCAGGTCCCGAATTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199051
FAM5C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 5, member C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-2144s1c1
Sequence:CCGGCCCAATGGTAATGAGAGCATTCTCGAGAATGCTCTCATTACCATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-1145s1c1
Sequence:CCGGCGAATAACTGAAACCTGGAAACTCGAGTTTCCAGGTTTCAGTTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152416    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199051.1-2675s1c1
Sequence:CCGGCACACATGAACTTGCTGACAACTCGAGTTGTCAGCAAGTTCATGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-1366s1c1
Sequence:CCGGCCTTAGCAAGAGGTGTCATAACTCGAGTTATGACACCTCTTGCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-436s1c1
Sequence:CCGGGCAGGGATTTAGCACAAGATACTCGAGTATCTTGTGCTAAATCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-806s1c1
Sequence:CCGGCTTCGGAGACTTCACCACATTCTCGAGAATGTGGTGAAGTCTCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199051.1-809s1c1
Sequence:CCGGCGGAGACTTCACCACATTCAACTCGAGTTGAATGTGGTGAAGTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-287s1c1
Sequence:CCGGGAGTGGATAGCACTGAGTCTTCTCGAGAAGACTCAGTGCTATCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199051.1-2264s1c1
Sequence:CCGGGAAGCAATTCGGGACCTGATTCTCGAGAATCAGGTCCCGAATTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153539
FAM5C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 5, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153539.1-2435s1c1
Sequence:CCGGGTGGAAGTTTATGTTTGGAAACTCGAGTTTCCAAACATAAACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-1562s1c1
Sequence:CCGGCCTAGAGATGAAATACCTGTTCTCGAGAACAGGTATTTCATCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-1993s1c1
Sequence:CCGGCCAACAGCAATGAGAGCATTTCTCGAGAAATGCTCTCATTGCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-577s1c1
Sequence:CCGGGCACCAATAGTTCGTCTGTTACTCGAGTAACAGACGAACTATTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-887s1c1
Sequence:CCGGCGAGTTTATCTGCAAGGATAACTCGAGTTATCCTTGCAGATAAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153539
FAM5C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 5, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153539.1-2435s1c1
Sequence:CCGGGTGGAAGTTTATGTTTGGAAACTCGAGTTTCCAAACATAAACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-1562s1c1
Sequence:CCGGCCTAGAGATGAAATACCTGTTCTCGAGAACAGGTATTTCATCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-1993s1c1
Sequence:CCGGCCAACAGCAATGAGAGCATTTCTCGAGAAATGCTCTCATTGCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-577s1c1
Sequence:CCGGGCACCAATAGTTCGTCTGTTACTCGAGTAACAGACGAACTATTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-887s1c1
Sequence:CCGGCGAGTTTATCTGCAAGGATAACTCGAGTTATCCTTGCAGATAAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153539
FAM5C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 5, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153539.1-2435s1c1
Sequence:CCGGGTGGAAGTTTATGTTTGGAAACTCGAGTTTCCAAACATAAACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-1562s1c1
Sequence:CCGGCCTAGAGATGAAATACCTGTTCTCGAGAACAGGTATTTCATCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-1993s1c1
Sequence:CCGGCCAACAGCAATGAGAGCATTTCTCGAGAAATGCTCTCATTGCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-577s1c1
Sequence:CCGGGCACCAATAGTTCGTCTGTTACTCGAGTAACAGACGAACTATTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153539.1-887s1c1
Sequence:CCGGCGAGTTTATCTGCAAGGATAACTCGAGTTATCCTTGCAGATAAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)