EMAIL THIS PAGE TO A FRIEND

FAM60A

family with sequence similarity 60, member A

Synonyms: C12orf14 TERA
UniProtKB ID: Q9NP50, D3DUV8, Q9BSZ8
Gene ID:
Mouse(56306) family with sequence similarity 60, member A
Rat(686611) family with sequence similarity 60, member A
Zebrafish(563991) family with sequence similarity 60, member A
chicken(418140) family with sequence similarity 60, member A
domestic cat(101088089) family with sequence similarity 60, member A
cow(538649) family with sequence similarity 60, member A
sheep(101107512) family with sequence similarity 60, member A
domestic guinea pig(100716438) family with sequence similarity 60, member A
213 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001135811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135811 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021238 Rosetta Predictions human pricing
NM_001134711 Rosetta Predictions rat pricing
NM_001134712 Rosetta Predictions rat pricing
NM_019643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082184 predicted 691
2 SASI_Hs01_00082185 predicted 1339
3 SASI_Hs02_00354873 predicted 594
4 SASI_Hs01_00082187 predicted 669
5 SASI_Hs01_00082188 predicted 1282
6 SASI_Hs02_00354874 predicted 604
7 SASI_Hs01_00082191 predicted 783
8 SASI_Hs01_00082193 predicted 671
9 SASI_Hs02_00354875 predicted 844
10 SASI_Hs02_00354876 predicted 409
11 SASI_Hs01_00082186 predicted 428
12 SASI_Hs01_00082189 predicted 857
13 SASI_Hs01_00082190 predicted 357
14 SASI_Hs01_00082192 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258104 predicted 1404
2 SASI_Rn02_00258105 predicted 1397
3 SASI_Rn02_00258106 predicted 1276
4 SASI_Rn02_00258107 predicted 716
5 SASI_Rn02_00258108 predicted 1018
6 SASI_Rn02_00258109 predicted 1275
7 SASI_Rn02_00258110 predicted 1445
8 SASI_Rn02_00258111 predicted 805
9 SASI_Rn02_00258112 predicted 772
10 SASI_Rn02_00258113 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258114 predicted 1239
2 SASI_Rn02_00258115 predicted 1237
3 SASI_Rn02_00258116 predicted 1117
4 SASI_Rn02_00258117 predicted 856
5 SASI_Rn02_00258118 predicted 1110
6 SASI_Rn02_00258119 predicted 1276
7 SASI_Rn02_00258120 predicted 607
8 SASI_Rn02_00258121 predicted 812
9 SASI_Rn02_00258122 predicted 1122
10 SASI_Rn02_00258123 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324681 predicted 482
2 SASI_Mm01_00158659 predicted 971
3 SASI_Mm01_00158661 predicted 883
4 SASI_Mm01_00158662 predicted 957
5 SASI_Mm02_00324682 predicted 481
6 SASI_Mm01_00158664 predicted 448
7 SASI_Mm02_00324683 predicted 910
8 SASI_Mm02_00324684 predicted 423
9 SASI_Mm02_00324685 predicted 483
10 SASI_Mm02_00324686 predicted 966
11 SASI_Mm01_00158656 predicted 410
12 SASI_Mm01_00158657 predicted 1025
13 SASI_Mm01_00158658 predicted 247
14 SASI_Mm01_00158660 predicted 400
15 SASI_Mm01_00158663 predicted 192
16 SASI_Mm01_00158665 predicted 182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019643
VALIDATED
FAM60A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 60, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019643.1-799s1c1
Sequence:CCGGGAAGTCCTCATCGACACTCATCTCGAGATGAGTGTCGATGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019643.1-2274s1c1
Sequence:CCGGCCACAGTTTGTGGCATCCTATCTCGAGATAGGATGCCACAAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-236s21c1
Sequence:CCGGTCCCGGTTCACGGACAGTAAACTCGAGTTTACTGTCCGTGAACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-2094s21c1
Sequence:CCGGATACGTGGCTGCCTTAGTATTCTCGAGAATACTAAGGCAGCCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-401s21c1
Sequence:CCGGAGAGCAGGCCCTAGTCTAAAGCTCGAGCTTTAGACTAGGGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019643.3-410s1c1
Sequence:CCGGCCTAGTCTAAAGACAACATTGCTCGAGCAATGTTGTCTTTAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-678s21c1
Sequence:CCGGGTTGTGGGATCATCTATAAAGCTCGAGCTTTATAGATGATCCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-819s21c1
Sequence:CCGGAGTGGTGACTGAGGTTCATTTCTCGAGAAATGAACCTCAGTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019643
VALIDATED
FAM60A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 60, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019643.1-799s1c1
Sequence:CCGGGAAGTCCTCATCGACACTCATCTCGAGATGAGTGTCGATGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019643.1-2274s1c1
Sequence:CCGGCCACAGTTTGTGGCATCCTATCTCGAGATAGGATGCCACAAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-236s21c1
Sequence:CCGGTCCCGGTTCACGGACAGTAAACTCGAGTTTACTGTCCGTGAACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-2094s21c1
Sequence:CCGGATACGTGGCTGCCTTAGTATTCTCGAGAATACTAAGGCAGCCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-401s21c1
Sequence:CCGGAGAGCAGGCCCTAGTCTAAAGCTCGAGCTTTAGACTAGGGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019643.3-410s1c1
Sequence:CCGGCCTAGTCTAAAGACAACATTGCTCGAGCAATGTTGTCTTTAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-678s21c1
Sequence:CCGGGTTGTGGGATCATCTATAAAGCTCGAGCTTTATAGATGATCCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-819s21c1
Sequence:CCGGAGTGGTGACTGAGGTTCATTTCTCGAGAAATGAACCTCAGTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019643
VALIDATED
FAM60A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 60, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019643.1-799s1c1
Sequence:CCGGGAAGTCCTCATCGACACTCATCTCGAGATGAGTGTCGATGAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019643.1-2274s1c1
Sequence:CCGGCCACAGTTTGTGGCATCCTATCTCGAGATAGGATGCCACAAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-236s21c1
Sequence:CCGGTCCCGGTTCACGGACAGTAAACTCGAGTTTACTGTCCGTGAACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-2094s21c1
Sequence:CCGGATACGTGGCTGCCTTAGTATTCTCGAGAATACTAAGGCAGCCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-401s21c1
Sequence:CCGGAGAGCAGGCCCTAGTCTAAAGCTCGAGCTTTAGACTAGGGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019643.3-410s1c1
Sequence:CCGGCCTAGTCTAAAGACAACATTGCTCGAGCAATGTTGTCTTTAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-678s21c1
Sequence:CCGGGTTGTGGGATCATCTATAAAGCTCGAGCTTTATAGATGATCCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019643.3-819s21c1
Sequence:CCGGAGTGGTGACTGAGGTTCATTTCTCGAGAAATGAACCTCAGTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135811
VALIDATED
FAM60A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 60, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-902s21c1
Sequence:CCGGCAAGCCTTGCTGCAGCAATAACTCGAGTTATTGCTGCAGCAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135811.1-2868s21c1
Sequence:CCGGGGTGGTAGAATATACTATAATCTCGAGATTATAGTATATTCTACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-402s21c1
Sequence:CCGGTCTCGATTCACTGACAGTAAACTCGAGTTTACTGTCAGTGAATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-841s21c1
Sequence:CCGGTATGTTGTGGGATCATCTATACTCGAGTATAGATGATCCCACAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-662s21c1
Sequence:CCGGGAAGGAATTTAAACGTCATAACTCGAGTTATGACGTTTAAATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135811
VALIDATED
FAM60A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 60, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-902s21c1
Sequence:CCGGCAAGCCTTGCTGCAGCAATAACTCGAGTTATTGCTGCAGCAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135811.1-2868s21c1
Sequence:CCGGGGTGGTAGAATATACTATAATCTCGAGATTATAGTATATTCTACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-402s21c1
Sequence:CCGGTCTCGATTCACTGACAGTAAACTCGAGTTTACTGTCAGTGAATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-841s21c1
Sequence:CCGGTATGTTGTGGGATCATCTATACTCGAGTATAGATGATCCCACAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-662s21c1
Sequence:CCGGGAAGGAATTTAAACGTCATAACTCGAGTTATGACGTTTAAATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135811
VALIDATED
FAM60A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 60, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-902s21c1
Sequence:CCGGCAAGCCTTGCTGCAGCAATAACTCGAGTTATTGCTGCAGCAAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135811.1-2868s21c1
Sequence:CCGGGGTGGTAGAATATACTATAATCTCGAGATTATAGTATATTCTACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-402s21c1
Sequence:CCGGTCTCGATTCACTGACAGTAAACTCGAGTTTACTGTCAGTGAATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-841s21c1
Sequence:CCGGTATGTTGTGGGATCATCTATACTCGAGTATAGATGATCCCACAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001135811.1-662s21c1
Sequence:CCGGGAAGGAATTTAAACGTCATAACTCGAGTTATGACGTTTAAATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks