EMAIL THIS PAGE TO A FRIEND

FAM63A

family with sequence similarity 63, member A

62 Gene Product Result for
Synonyms: RP11-316M1.5
Gene ID:
Mouse(75007) family with sequence similarity 63, member A
Rat(310665) family with sequence similarity 63, member A
Zebrafish(563470) family with sequence similarity 63, member A
domestic cat(101094866) family with sequence similarity 63, member A
cow(505719) family with sequence similarity 63, member A
dog(483188) family with sequence similarity 63, member A
domestic guinea pig(100725698) family with sequence similarity 63, member A
naked mole-rat(101711195) family with sequence similarity 63, member A
sheep(101110011) family with sequence similarity 63, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040217 Rosetta Predictions human pricing
NM_018379 Rosetta Predictions human pricing
NM_001025118 Rosetta Predictions rat pricing
NM_133858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094199 predicted 1797
2 SASI_Hs01_00094200 predicted 1173
3 SASI_Hs01_00094201 predicted 883
4 SASI_Hs01_00094202 predicted 1323
5 SASI_Hs01_00094203 predicted 1336
6 SASI_Hs01_00094204 predicted 1076
7 SASI_Hs01_00094205 predicted 1636
8 SASI_Hs01_00094206 predicted 1255
9 SASI_Hs01_00094207 predicted 1218
10 SASI_Hs01_00094208 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178167 predicted 2388
2 SASI_Hs01_00178168 predicted 1752
3 SASI_Hs01_00178169 predicted 1474
4 SASI_Hs01_00178170 predicted 1914
5 SASI_Hs01_00178171 predicted 1660
6 SASI_Hs01_00178172 predicted 2220
7 SASI_Hs01_00178173 predicted 1373
8 SASI_Hs01_00178174 predicted 1328
9 SASI_Hs01_00178175 predicted 1834
10 SASI_Hs01_00178176 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054371 predicted 1656
2 SASI_Rn01_00054372 predicted 771
3 SASI_Rn01_00054373 predicted 1272
4 SASI_Rn01_00054374 predicted 951
5 SASI_Rn01_00054375 predicted 1279
6 SASI_Rn01_00054377 predicted 504
7 SASI_Rn01_00054378 predicted 755
8 SASI_Rn01_00054379 predicted 1680
9 SASI_Rn02_00203015 predicted 581
10 SASI_Rn01_00054380 predicted 973
11 SASI_Rn01_00054376 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047624 predicted 1030
2 SASI_Mm01_00047625 predicted 1537
3 SASI_Mm01_00047626 predicted 1469
4 SASI_Mm01_00047627 predicted 2080
5 SASI_Mm01_00047628 predicted 1552
6 SASI_Mm01_00047629 predicted 1309
7 SASI_Mm01_00047630 predicted 1574
8 SASI_Mm01_00047632 predicted 1026
9 SASI_Mm01_00047633 predicted 1752
10 SASI_Mm02_00338919 predicted 2286
11 SASI_Mm01_00047631 predicted 1672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018379
VALIDATED
FAM63A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 63, member A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1582s21c1
Sequence:CCGGCCACAGGTCTGGATGTCAATGCTCGAGCATTGACATCCAGACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1223s21c1
Sequence:CCGGGCCTGAAGTAGAGACAATAAGCTCGAGCTTATTGTCTCTACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1607s21c1
Sequence:CCGGATTCACAGGCGTCTCTGATTTCTCGAGAAATCAGAGACGCCTGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1350s21c1
Sequence:CCGGATCATCACCCAGAGCACTAACCTCGAGGTTAGTGCTCTGGGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018379.4-2460s21c1
Sequence:CCGGGATGTGCTGGATAACTTATTTCTCGAGAAATAAGTTATCCAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1557s21c1
Sequence:CCGGGCAATGACAGTGCTGCCTAAACTCGAGTTTAGGCAGCACTGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1795s21c1
Sequence:CCGGTCGTGACAGAAGGCCTGATTGCTCGAGCAATCAGGCCTTCTGTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018379.2-992s1c1
Sequence:CCGGCAGAGGGACTTCAGCTTAATTCTCGAGAATTAAGCTGAAGTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-1413s1c1
Sequence:CCGGGACTAAGCATAAGAGTCACTTCTCGAGAAGTGACTCTTATGCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-2233s1c1
Sequence:CCGGGAGCTTAATTTGGGTTTCTATCTCGAGATAGAAACCCAAATTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-494s1c1
Sequence:CCGGCAGAAGCAGTCATCCCTGAAACTCGAGTTTCAGGGATGACTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018379
VALIDATED
FAM63A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 63, member A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1582s21c1
Sequence:CCGGCCACAGGTCTGGATGTCAATGCTCGAGCATTGACATCCAGACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1223s21c1
Sequence:CCGGGCCTGAAGTAGAGACAATAAGCTCGAGCTTATTGTCTCTACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1607s21c1
Sequence:CCGGATTCACAGGCGTCTCTGATTTCTCGAGAAATCAGAGACGCCTGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1350s21c1
Sequence:CCGGATCATCACCCAGAGCACTAACCTCGAGGTTAGTGCTCTGGGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018379.4-2460s21c1
Sequence:CCGGGATGTGCTGGATAACTTATTTCTCGAGAAATAAGTTATCCAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1557s21c1
Sequence:CCGGGCAATGACAGTGCTGCCTAAACTCGAGTTTAGGCAGCACTGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1795s21c1
Sequence:CCGGTCGTGACAGAAGGCCTGATTGCTCGAGCAATCAGGCCTTCTGTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018379.2-992s1c1
Sequence:CCGGCAGAGGGACTTCAGCTTAATTCTCGAGAATTAAGCTGAAGTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-1413s1c1
Sequence:CCGGGACTAAGCATAAGAGTCACTTCTCGAGAAGTGACTCTTATGCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-2233s1c1
Sequence:CCGGGAGCTTAATTTGGGTTTCTATCTCGAGATAGAAACCCAAATTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-494s1c1
Sequence:CCGGCAGAAGCAGTCATCCCTGAAACTCGAGTTTCAGGGATGACTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018379
VALIDATED
FAM63A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 63, member A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1582s21c1
Sequence:CCGGCCACAGGTCTGGATGTCAATGCTCGAGCATTGACATCCAGACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1223s21c1
Sequence:CCGGGCCTGAAGTAGAGACAATAAGCTCGAGCTTATTGTCTCTACTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1607s21c1
Sequence:CCGGATTCACAGGCGTCTCTGATTTCTCGAGAAATCAGAGACGCCTGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1350s21c1
Sequence:CCGGATCATCACCCAGAGCACTAACCTCGAGGTTAGTGCTCTGGGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018379.4-2460s21c1
Sequence:CCGGGATGTGCTGGATAACTTATTTCTCGAGAAATAAGTTATCCAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1557s21c1
Sequence:CCGGGCAATGACAGTGCTGCCTAAACTCGAGTTTAGGCAGCACTGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018379.4-1795s21c1
Sequence:CCGGTCGTGACAGAAGGCCTGATTGCTCGAGCAATCAGGCCTTCTGTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018379.2-992s1c1
Sequence:CCGGCAGAGGGACTTCAGCTTAATTCTCGAGAATTAAGCTGAAGTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-1413s1c1
Sequence:CCGGGACTAAGCATAAGAGTCACTTCTCGAGAAGTGACTCTTATGCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-2233s1c1
Sequence:CCGGGAGCTTAATTTGGGTTTCTATCTCGAGATAGAAACCCAAATTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018379.2-494s1c1
Sequence:CCGGCAGAAGCAGTCATCCCTGAAACTCGAGTTTCAGGGATGACTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133858
FAM63A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 63, member A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.3-2219s1c1
Sequence:CCGGCAACAAGAAGAGTATCAACAACTCGAGTTGTTGATACTCTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.3-1916s1c1
Sequence:CCGGCTTAGTGTCTTCTTTCGAAACCTCGAGGTTTCGAAAGAAGACACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2519s21c1
Sequence:CCGGGCTATCTTCTCTTCCTCTCTTCTCGAGAAGAGAGGAAGAGAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2437s21c1
Sequence:CCGGGAATAACCTATATGCACTGTTCTCGAGAACAGTGCATATAGGTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2429s21c1
Sequence:CCGGGACACAGAGAATAACCTATATCTCGAGATATAGGTTATTCTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133858.3-1640s21c1
Sequence:CCGGGACTTTGAGTATACGCCGGAACTCGAGTTCCGGCGTATACTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.2-1536s1c1
Sequence:CCGGGAGGGCCTTCAACTTAACTTTCTCGAGAAAGTTAAGTTGAAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2520s1c1
Sequence:CCGGGCTATCTTCTCTTCCTCTCTTCTCGAGAAGAGAGGAAGAGAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2438s1c1
Sequence:CCGGGAATAACCTATATGCACTGTTCTCGAGAACAGTGCATATAGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133858.2-1666s1c1
Sequence:CCGGGCATCTTTGACTTGCTGGGAACTCGAGTTCCCAGCAAGTCAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133858.2-1641s1c1
Sequence:CCGGGACTTTGAGTATACGCCGGAACTCGAGTTCCGGCGTATACTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2430s1c1
Sequence:CCGGGACACAGAGAATAACCTATATCTCGAGATATAGGTTATTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133858
FAM63A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 63, member A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.3-2219s1c1
Sequence:CCGGCAACAAGAAGAGTATCAACAACTCGAGTTGTTGATACTCTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.3-1916s1c1
Sequence:CCGGCTTAGTGTCTTCTTTCGAAACCTCGAGGTTTCGAAAGAAGACACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2519s21c1
Sequence:CCGGGCTATCTTCTCTTCCTCTCTTCTCGAGAAGAGAGGAAGAGAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2437s21c1
Sequence:CCGGGAATAACCTATATGCACTGTTCTCGAGAACAGTGCATATAGGTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2429s21c1
Sequence:CCGGGACACAGAGAATAACCTATATCTCGAGATATAGGTTATTCTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133858.3-1640s21c1
Sequence:CCGGGACTTTGAGTATACGCCGGAACTCGAGTTCCGGCGTATACTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.2-1536s1c1
Sequence:CCGGGAGGGCCTTCAACTTAACTTTCTCGAGAAAGTTAAGTTGAAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2520s1c1
Sequence:CCGGGCTATCTTCTCTTCCTCTCTTCTCGAGAAGAGAGGAAGAGAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2438s1c1
Sequence:CCGGGAATAACCTATATGCACTGTTCTCGAGAACAGTGCATATAGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133858.2-1666s1c1
Sequence:CCGGGCATCTTTGACTTGCTGGGAACTCGAGTTCCCAGCAAGTCAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133858.2-1641s1c1
Sequence:CCGGGACTTTGAGTATACGCCGGAACTCGAGTTCCGGCGTATACTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2430s1c1
Sequence:CCGGGACACAGAGAATAACCTATATCTCGAGATATAGGTTATTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133858
FAM63A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 63, member A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.3-2219s1c1
Sequence:CCGGCAACAAGAAGAGTATCAACAACTCGAGTTGTTGATACTCTTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.3-1916s1c1
Sequence:CCGGCTTAGTGTCTTCTTTCGAAACCTCGAGGTTTCGAAAGAAGACACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2519s21c1
Sequence:CCGGGCTATCTTCTCTTCCTCTCTTCTCGAGAAGAGAGGAAGAGAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2437s21c1
Sequence:CCGGGAATAACCTATATGCACTGTTCTCGAGAACAGTGCATATAGGTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133858.3-2429s21c1
Sequence:CCGGGACACAGAGAATAACCTATATCTCGAGATATAGGTTATTCTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133858.3-1640s21c1
Sequence:CCGGGACTTTGAGTATACGCCGGAACTCGAGTTCCGGCGTATACTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133858.2-1536s1c1
Sequence:CCGGGAGGGCCTTCAACTTAACTTTCTCGAGAAAGTTAAGTTGAAGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2520s1c1
Sequence:CCGGGCTATCTTCTCTTCCTCTCTTCTCGAGAAGAGAGGAAGAGAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2438s1c1
Sequence:CCGGGAATAACCTATATGCACTGTTCTCGAGAACAGTGCATATAGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133858.2-1666s1c1
Sequence:CCGGGCATCTTTGACTTGCTGGGAACTCGAGTTCCCAGCAAGTCAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133858.2-1641s1c1
Sequence:CCGGGACTTTGAGTATACGCCGGAACTCGAGTTCCGGCGTATACTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133858.2-2430s1c1
Sequence:CCGGGACACAGAGAATAACCTATATCTCGAGATATAGGTTATTCTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks