EMAIL THIS PAGE TO A FRIEND

FAM64A

family with sequence similarity 64, member A

115 Gene Product Result for
Synonyms: CATS RCS1
UniProtKB ID: Q9BSJ6, Q96CT4, Q9NVV1, Q9NWB5
Gene ID:
Mouse(109212) family with sequence similarity 64, member A
Rat(360559) family with sequence similarity 64, member A
chicken(417685) family with sequence similarity 64, member A
dog(489446) family with sequence similarity 64, member A
cow(540455) family with sequence similarity 64, member A
domestic cat(101088791) family with sequence similarity 64, member A
domestic guinea pig(100723640) family with sequence similarity 64, member A
naked mole-rat(101707274) family with sequence similarity 64, member A
sheep(101104673) family with sequence similarity 64, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019013 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019013 Rosetta Predictions human pricing
NM_001113781 Rosetta Predictions rat pricing
NM_144526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120472 predicted 726
2 SASI_Hs01_00120473 predicted 688
3 SASI_Hs01_00120474 predicted 738
4 SASI_Hs01_00120475 predicted 560
5 SASI_Hs01_00120476 predicted 735
6 SASI_Hs01_00120477 predicted 435
7 SASI_Hs01_00120478 predicted 734
8 SASI_Hs01_00120479 predicted 546
9 SASI_Hs01_00120480 predicted 458
10 SASI_Hs01_00120481 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252073 predicted 1067
2 SASI_Rn02_00252074 predicted 727
3 SASI_Rn02_00252075 predicted 1044
4 SASI_Rn02_00252076 predicted 1096
5 SASI_Rn02_00252077 predicted 273
6 SASI_Rn02_00252078 predicted 740
7 SASI_Rn02_00252079 predicted 1047
8 SASI_Rn02_00252080 predicted 911
9 SASI_Rn02_00252081 predicted 861
10 SASI_Rn02_00252082 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062055 predicted 746
2 SASI_Mm01_00062056 predicted 390
3 SASI_Mm01_00062057 predicted 609
4 SASI_Mm01_00062058 predicted 265
5 SASI_Mm01_00062059 predicted 1070
6 SASI_Mm01_00062060 predicted 749
7 SASI_Mm01_00062061 predicted 410
8 SASI_Mm01_00062062 predicted 739
9 SASI_Mm01_00062063 predicted 1091
10 SASI_Mm01_00062064 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019013
VALIDATED
FAM64A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 64, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019013.1-1098s21c1
Sequence:CCGCAGTGCTAGCATCAGATATTTGCTCGAGCAAATATCTGATGCTAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019013.1-1060s21c1
Sequence:CCGGTGACCTTGAGCCTTCTATTTGCTCGAGCAAATAGAAGGCTCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-561s1c1
Sequence:CCGGCCCACCCATTACGGCGATCAACTCGAGTTGATCGCCGTAATGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_019013.1-740s1c1
Sequence:CCGGGACATCGTCTCTCTCATTCATCTCGAGATGAATGAGAGAGACGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_019013.1-695s1c1
Sequence:CCGGCTGTCCCAAGAGCTAGATGAACTCGAGTTCATCTAGCTCTTGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-357s1c1
Sequence:CCGGCCTGCCAAAGTGGCACCAAGTCTCGAGACTTGGTGCCACTTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-307s1c1
Sequence:CCGGTCGCTCAGCTAAGAGTGCTTTCTCGAGAAAGCACTCTTAGCTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019013
VALIDATED
FAM64A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 64, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019013.1-1098s21c1
Sequence:CCGCAGTGCTAGCATCAGATATTTGCTCGAGCAAATATCTGATGCTAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019013.1-1060s21c1
Sequence:CCGGTGACCTTGAGCCTTCTATTTGCTCGAGCAAATAGAAGGCTCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-561s1c1
Sequence:CCGGCCCACCCATTACGGCGATCAACTCGAGTTGATCGCCGTAATGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_019013.1-740s1c1
Sequence:CCGGGACATCGTCTCTCTCATTCATCTCGAGATGAATGAGAGAGACGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_019013.1-695s1c1
Sequence:CCGGCTGTCCCAAGAGCTAGATGAACTCGAGTTCATCTAGCTCTTGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-357s1c1
Sequence:CCGGCCTGCCAAAGTGGCACCAAGTCTCGAGACTTGGTGCCACTTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-307s1c1
Sequence:CCGGTCGCTCAGCTAAGAGTGCTTTCTCGAGAAAGCACTCTTAGCTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019013
VALIDATED
FAM64A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 64, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019013.1-1098s21c1
Sequence:CCGCAGTGCTAGCATCAGATATTTGCTCGAGCAAATATCTGATGCTAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019013.1-1060s21c1
Sequence:CCGGTGACCTTGAGCCTTCTATTTGCTCGAGCAAATAGAAGGCTCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-561s1c1
Sequence:CCGGCCCACCCATTACGGCGATCAACTCGAGTTGATCGCCGTAATGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_019013.1-740s1c1
Sequence:CCGGGACATCGTCTCTCTCATTCATCTCGAGATGAATGAGAGAGACGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_019013.1-695s1c1
Sequence:CCGGCTGTCCCAAGAGCTAGATGAACTCGAGTTCATCTAGCTCTTGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-357s1c1
Sequence:CCGGCCTGCCAAAGTGGCACCAAGTCTCGAGACTTGGTGCCACTTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019013.1-307s1c1
Sequence:CCGGTCGCTCAGCTAAGAGTGCTTTCTCGAGAAAGCACTCTTAGCTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144526
FAM64A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 64, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-964s1c1
Sequence:CCGGCCACAGCCTGAGAGTTATTTACTCGAGTAAATAACTCTCAGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-1287s1c1
Sequence:CCGGGAGCCTACTTATCTTCTCCATCTCGAGATGGAGAAGATAAGTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144526.2-398s1c1
Sequence:CCGGGAGACACAGGTGAAAGTGAGACTCGAGTCTCACTTTCACCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-1067s1c1
Sequence:CCGGGCTTCATAGTTGTCCATCCATCTCGAGATGGATGGACAACTATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144526
FAM64A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 64, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-964s1c1
Sequence:CCGGCCACAGCCTGAGAGTTATTTACTCGAGTAAATAACTCTCAGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-1287s1c1
Sequence:CCGGGAGCCTACTTATCTTCTCCATCTCGAGATGGAGAAGATAAGTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144526.2-398s1c1
Sequence:CCGGGAGACACAGGTGAAAGTGAGACTCGAGTCTCACTTTCACCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-1067s1c1
Sequence:CCGGGCTTCATAGTTGTCCATCCATCTCGAGATGGATGGACAACTATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144526
FAM64A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 64, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-964s1c1
Sequence:CCGGCCACAGCCTGAGAGTTATTTACTCGAGTAAATAACTCTCAGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-1287s1c1
Sequence:CCGGGAGCCTACTTATCTTCTCCATCTCGAGATGGAGAAGATAAGTAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144526.2-398s1c1
Sequence:CCGGGAGACACAGGTGAAAGTGAGACTCGAGTCTCACTTTCACCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144526.2-1067s1c1
Sequence:CCGGGCTTCATAGTTGTCCATCCATCTCGAGATGGATGGACAACTATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks