EMAIL THIS PAGE TO A FRIEND

FAM65A

family with sequence similarity 65, member A

79 Gene Product Result for
Gene ID:
Mouse(75687) family with sequence similarity 65, member A
Rat(291974) family with sequence similarity 65, member A
sheep(101114044) family with sequence similarity 65, member A
naked mole-rat(101710406) family with sequence similarity 65, member A
domestic guinea pig(100730473) family with sequence similarity 65, member A
Zebrafish(566573) family with sequence similarity 65, member A
cow(619120) family with sequence similarity 65, member A
cow(100336872) family with sequence similarity 65, member A
domestic cat(101101099) family with sequence similarity 65, member A
dog(489757) family with sequence similarity 65, member A
chicken(415665) family with sequence similarity 65, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024519 Rosetta Predictions human pricing
XM_001075785 Rosetta Predictions rat pricing
XM_214666 Rosetta Predictions rat pricing
NM_001081241 Rosetta Predictions mouse pricing
XM_486159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016836 predicted 3839
2 SASI_Hs01_00016838 predicted 1743
3 SASI_Hs01_00016839 predicted 1892
4 SASI_Hs01_00016840 predicted 801
5 SASI_Hs02_00356798 predicted 1139
6 SASI_Hs01_00016841 predicted 1667
7 SASI_Hs01_00016842 predicted 1394
8 SASI_Hs01_00016843 predicted 1427
9 SASI_Hs01_00016844 predicted 386
10 SASI_Hs01_00016845 predicted 403
11 SASI_Hs01_00016837 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351031 predicted 969
2 SASI_Rn02_00351032 predicted 702
3 SASI_Rn02_00351033 predicted 1490
4 SASI_Rn02_00351034 predicted 349
5 SASI_Rn02_00351035 predicted 676
6 SASI_Rn02_00351036 predicted 1280
7 SASI_Rn02_00351037 predicted 504
8 SASI_Rn02_00351038 predicted 3467
9 SASI_Rn02_00351039 predicted 1110
10 SASI_Rn02_00351040 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375495 predicted 964
2 SASI_Rn02_00375496 predicted 698
3 SASI_Rn02_00375497 predicted 1498
4 SASI_Rn02_00375498 predicted 351
5 SASI_Rn02_00375499 predicted 678
6 SASI_Rn02_00375500 predicted 1279
7 SASI_Rn02_00375501 predicted 502
8 SASI_Rn02_00375502 predicted 3468
9 SASI_Rn02_00375503 predicted 1112
10 SASI_Rn02_00375504 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296557 predicted 1787
2 SASI_Mm02_00296558 predicted 3363
3 SASI_Mm02_00296559 predicted 3281
4 SASI_Mm02_00296560 predicted 2053
5 SASI_Mm02_00296561 predicted 2085
6 SASI_Mm02_00296562 predicted 1795
7 SASI_Mm02_00296563 predicted 462
8 SASI_Mm02_00296564 predicted 559
9 SASI_Mm02_00296565 predicted 2970
10 SASI_Mm02_00296566 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257043 predicted 3809
2 SASI_Mm01_00257044 predicted 3781
3 SASI_Mm01_00257045 predicted 3976
4 SASI_Mm01_00257046 predicted 3945
5 SASI_Mm01_00257047 predicted 3862
6 SASI_Mm01_00257048 predicted 3747
7 SASI_Mm01_00257049 predicted 3873
8 SASI_Mm01_00257050 predicted 3940
9 SASI_Mm01_00257051 predicted 3858
10 SASI_Mm01_00257052 predicted 3942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024519
VALIDATED
FAM65A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 65, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024519.2-2650s1c1
Sequence:CCGGGAAGACGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-696s1c1
Sequence:CCGGCGAGTTTCATCTCCGAATGAACTCGAGTTCATTCGGAGATGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024519.2-856s1c1
Sequence:CCGGCTCCCTCTACTCACGGAATTTCTCGAGAAATTCCGTGAGTAGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-750s1c1
Sequence:CCGGCGATCAGTATGAGATCTGCATCTCGAGATGCAGATCTCATACTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-3289s1c1
Sequence:CCGGCGGAATCTGAACTCGGATGATCTCGAGATCATCCGAGTTCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-867s1c1
Sequence:CCGGCACGGAATTTCTGTCTATTAACTCGAGTTAATAGACAGAAATTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-867s21c1
Sequence:CCGGCACGGAATTTCTGTCTATTAACTCGAGTTAATAGACAGAAATTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-3289s21c1
Sequence:CCGGCGGAATCTGAACTCGGATGATCTCGAGATCATCCGAGTTCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-2650s21c1
Sequence:CCGGGAAGACGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024519
VALIDATED
FAM65A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 65, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024519.2-2650s1c1
Sequence:CCGGGAAGACGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-696s1c1
Sequence:CCGGCGAGTTTCATCTCCGAATGAACTCGAGTTCATTCGGAGATGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024519.2-856s1c1
Sequence:CCGGCTCCCTCTACTCACGGAATTTCTCGAGAAATTCCGTGAGTAGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-750s1c1
Sequence:CCGGCGATCAGTATGAGATCTGCATCTCGAGATGCAGATCTCATACTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-3289s1c1
Sequence:CCGGCGGAATCTGAACTCGGATGATCTCGAGATCATCCGAGTTCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-867s1c1
Sequence:CCGGCACGGAATTTCTGTCTATTAACTCGAGTTAATAGACAGAAATTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-867s21c1
Sequence:CCGGCACGGAATTTCTGTCTATTAACTCGAGTTAATAGACAGAAATTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-3289s21c1
Sequence:CCGGCGGAATCTGAACTCGGATGATCTCGAGATCATCCGAGTTCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-2650s21c1
Sequence:CCGGGAAGACGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024519
VALIDATED
FAM65A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 65, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024519.2-2650s1c1
Sequence:CCGGGAAGACGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-696s1c1
Sequence:CCGGCGAGTTTCATCTCCGAATGAACTCGAGTTCATTCGGAGATGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024519.2-856s1c1
Sequence:CCGGCTCCCTCTACTCACGGAATTTCTCGAGAAATTCCGTGAGTAGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-750s1c1
Sequence:CCGGCGATCAGTATGAGATCTGCATCTCGAGATGCAGATCTCATACTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-3289s1c1
Sequence:CCGGCGGAATCTGAACTCGGATGATCTCGAGATCATCCGAGTTCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024519.2-867s1c1
Sequence:CCGGCACGGAATTTCTGTCTATTAACTCGAGTTAATAGACAGAAATTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-867s21c1
Sequence:CCGGCACGGAATTTCTGTCTATTAACTCGAGTTAATAGACAGAAATTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-3289s21c1
Sequence:CCGGCGGAATCTGAACTCGGATGATCTCGAGATCATCCGAGTTCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024519.2-2650s21c1
Sequence:CCGGGAAGACGAAGATGAAGACAATCTCGAGATTGTCTTCATCTTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081241
VALIDATED
FAM65A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 65, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-1955s21c1
Sequence:CCGGAGCCCTACCCATACTACTATACTCGAGTATAGTAGTATGGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081241.2-2203s21c1
Sequence:CCGGTTCTACAGACGTGGCTATAATCTCGAGATTATAGCCACGTCTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-1830s21c1
Sequence:CCGGGCCTAACTTCCACCACTATAGCTCGAGCTATAGTGGTGGAAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-436s21c1
Sequence:CCGGGAAGCTCCAGCGCCAGATAAACTCGAGTTTATCTGGCGCTGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081241.2-3963s21c1
Sequence:CCGGGGTTGGCAGAATGCCTGAAATCTCGAGATTTCAGGCATTCTGCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081241
VALIDATED
FAM65A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 65, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-1955s21c1
Sequence:CCGGAGCCCTACCCATACTACTATACTCGAGTATAGTAGTATGGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081241.2-2203s21c1
Sequence:CCGGTTCTACAGACGTGGCTATAATCTCGAGATTATAGCCACGTCTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-1830s21c1
Sequence:CCGGGCCTAACTTCCACCACTATAGCTCGAGCTATAGTGGTGGAAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-436s21c1
Sequence:CCGGGAAGCTCCAGCGCCAGATAAACTCGAGTTTATCTGGCGCTGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081241.2-3963s21c1
Sequence:CCGGGGTTGGCAGAATGCCTGAAATCTCGAGATTTCAGGCATTCTGCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081241
VALIDATED
FAM65A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 65, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-1955s21c1
Sequence:CCGGAGCCCTACCCATACTACTATACTCGAGTATAGTAGTATGGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081241.2-2203s21c1
Sequence:CCGGTTCTACAGACGTGGCTATAATCTCGAGATTATAGCCACGTCTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-1830s21c1
Sequence:CCGGGCCTAACTTCCACCACTATAGCTCGAGCTATAGTGGTGGAAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081241.2-436s21c1
Sequence:CCGGGAAGCTCCAGCGCCAGATAAACTCGAGTTTATCTGGCGCTGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081241.2-3963s21c1
Sequence:CCGGGGTTGGCAGAATGCCTGAAATCTCGAGATTTCAGGCATTCTGCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks