EMAIL THIS PAGE TO A FRIEND

FAM65B

family with sequence similarity 65, member B

Synonyms: C6orf32 DIFF40 DIFF48 MYONAP PL48
UniProtKB ID: Q9Y4F9, A6NHP2, Q13529, Q5VV37, Q5VV38, Q9BQ28
Gene ID:
Human(9750) Summary: The protein encoded by this gene stimulates the formation of a non-mitotic multinucleate syncytium from proliferative cytotrophoblasts during trophoblast differentiation. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(193385) family with sequence similarity 65, member B
Rat(306934) family with sequence similarity 65, member B
Zebrafish(563800) family with sequence similarity 65, member B
cow(539635) family with sequence similarity 65, member B
domestic cat(101097315) family with sequence similarity 65, member B
dog(488247) family with sequence similarity 65, member B
chicken(421003) family with sequence similarity 65, member B
domestic guinea pig(100736015) family with sequence similarity 65, member B
naked mole-rat(101718669) family with sequence similarity 65, member B
sheep(101117024) family with sequence similarity 65, member B
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014722 Rosetta Predictions human pricing
NM_015864 Rosetta Predictions human pricing
NM_001014009 Rosetta Predictions rat pricing
NM_001080381 Rosetta Predictions mouse pricing
NM_029679 Rosetta Predictions mouse pricing
NM_178658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346156 predicted 745
2 SASI_Hs02_00346157 predicted 942
3 SASI_Hs02_00346158 predicted 733
4 SASI_Hs02_00346159 predicted 712
5 SASI_Hs02_00346160 predicted 592
6 SASI_Hs02_00346161 predicted 373
7 SASI_Hs02_00346162 predicted 788
8 SASI_Hs02_00346163 predicted 574
9 SASI_Hs02_00346164 predicted 516
10 SASI_Hs02_00346165 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072123 predicted 996
2 SASI_Hs01_00072124 predicted 1202
3 SASI_Hs01_00072125 predicted 990
4 SASI_Hs01_00072127 predicted 968
5 SASI_Hs01_00072128 predicted 849
6 SASI_Hs01_00072129 predicted 621
7 SASI_Hs01_00072131 predicted 1044
8 SASI_Hs02_00348445 predicted 827
9 SASI_Hs02_00348446 predicted 767
10 SASI_Hs02_00348447 predicted 960
11 SASI_Hs01_00072126 predicted 1364
12 SASI_Hs01_00072130 predicted 530
13 SASI_Hs01_00072132 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201380 predicted 194
2 SASI_Rn02_00201381 predicted 813
3 SASI_Rn02_00201382 predicted 933
4 SASI_Rn02_00201383 predicted 1954
5 SASI_Rn02_00201384 predicted 2727
6 SASI_Rn02_00201385 predicted 1004
7 SASI_Rn02_00201386 predicted 2225
8 SASI_Rn02_00201387 predicted 1402
9 SASI_Rn02_00201388 predicted 2543
10 SASI_Rn02_00201389 predicted 2527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293383 predicted 866
2 SASI_Mm02_00293384 predicted 738
3 SASI_Mm02_00293385 predicted 924
4 SASI_Mm02_00293386 predicted 1156
5 SASI_Mm02_00293387 predicted 1821
6 SASI_Mm02_00293388 predicted 829
7 SASI_Mm02_00293389 predicted 659
8 SASI_Mm02_00293390 predicted 1893
9 SASI_Mm02_00293391 predicted 866
10 SASI_Mm02_00293392 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335698 predicted 872
2 SASI_Mm02_00335699 predicted 735
3 SASI_Mm02_00335700 predicted 924
4 SASI_Mm02_00335701 predicted 1149
5 SASI_Mm02_00335702 predicted 1828
6 SASI_Mm02_00335703 predicted 828
7 SASI_Mm02_00335704 predicted 657
8 SASI_Mm02_00335705 predicted 1893
9 SASI_Mm02_00335706 predicted 875
10 SASI_Mm02_00335707 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349096 predicted 723
2 SASI_Mm01_00173524 predicted 584
3 SASI_Mm01_00173525 predicted 771
4 SASI_Mm02_00349097 predicted 1003
5 SASI_Mm02_00349098 predicted 1551
6 SASI_Mm02_00349099 predicted 682
7 SASI_Mm02_00349100 predicted 499
8 SASI_Mm02_00349101 predicted 1612
9 SASI_Mm02_00349102 predicted 718
10 SASI_Mm02_00349103 predicted 1498
11 SASI_Mm01_00173523 predicted 288
12 SASI_Mm01_00173526 predicted 1099
13 SASI_Mm01_00173527 predicted 988
14 SASI_Mm01_00173528 predicted 479
15 SASI_Mm01_00173529 predicted 1118
16 SASI_Mm01_00173530 predicted 1503
17 SASI_Mm01_00173531 predicted 750
18 SASI_Mm01_00173532 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015864
FAM65B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 65, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-851s21c1
Sequence:CCGGTGAACTCTATGAAGCTTATTGCTCGAGCAATAAGCTTCATAGAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-780s21c1
Sequence:CCGGGACCTAGACAAGCAAATTAAACTCGAGTTTAATTTGCTTGTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-2165s21c1
Sequence:CCGGGAACCAAGAAGTCATGAATTTCTCGAGAAATTCATGACTTCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-820s21c1
Sequence:CCGGGACGCCTGGAGTTTCATATAACTCGAGTTATATGAAACTCCAGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2248s1c1
Sequence:CCGGCCTCCTCAGTGATCAACTCATCTCGAGATGAGTTGATCACTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015864.2-2068s1c1
Sequence:CCGGGCAGATCCTTTCTAGATGGAACTCGAGTTCCATCTAGAAAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2258s1c1
Sequence:CCGGGATCAACTCATGGCCAATCTTCTCGAGAAGATTGGCCATGAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2270s1c1
Sequence:CCGGGCCAATCTTGTTTCCTATTCTCTCGAGAGAATAGGAAACAAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015864
FAM65B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 65, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-851s21c1
Sequence:CCGGTGAACTCTATGAAGCTTATTGCTCGAGCAATAAGCTTCATAGAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-780s21c1
Sequence:CCGGGACCTAGACAAGCAAATTAAACTCGAGTTTAATTTGCTTGTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-2165s21c1
Sequence:CCGGGAACCAAGAAGTCATGAATTTCTCGAGAAATTCATGACTTCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-820s21c1
Sequence:CCGGGACGCCTGGAGTTTCATATAACTCGAGTTATATGAAACTCCAGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2248s1c1
Sequence:CCGGCCTCCTCAGTGATCAACTCATCTCGAGATGAGTTGATCACTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015864.2-2068s1c1
Sequence:CCGGGCAGATCCTTTCTAGATGGAACTCGAGTTCCATCTAGAAAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2258s1c1
Sequence:CCGGGATCAACTCATGGCCAATCTTCTCGAGAAGATTGGCCATGAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2270s1c1
Sequence:CCGGGCCAATCTTGTTTCCTATTCTCTCGAGAGAATAGGAAACAAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015864
FAM65B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 65, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-851s21c1
Sequence:CCGGTGAACTCTATGAAGCTTATTGCTCGAGCAATAAGCTTCATAGAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-780s21c1
Sequence:CCGGGACCTAGACAAGCAAATTAAACTCGAGTTTAATTTGCTTGTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-2165s21c1
Sequence:CCGGGAACCAAGAAGTCATGAATTTCTCGAGAAATTCATGACTTCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015864.2-820s21c1
Sequence:CCGGGACGCCTGGAGTTTCATATAACTCGAGTTATATGAAACTCCAGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2248s1c1
Sequence:CCGGCCTCCTCAGTGATCAACTCATCTCGAGATGAGTTGATCACTGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015864.2-2068s1c1
Sequence:CCGGGCAGATCCTTTCTAGATGGAACTCGAGTTCCATCTAGAAAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2258s1c1
Sequence:CCGGGATCAACTCATGGCCAATCTTCTCGAGAAGATTGGCCATGAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015864.2-2270s1c1
Sequence:CCGGGCCAATCTTGTTTCCTATTCTCTCGAGAGAATAGGAAACAAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178658
FAM65B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 65, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215873    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178658.4-2690s1c1
Sequence:CCGGCTTGAATGCATGAGATCAAATCTCGAGATTTGATCTCATGCATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.4-455s1c1
Sequence:CCGGCAAATTGACTGCTCAATTAAACTCGAGTTTAATTGAGCAGTCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-934s21c1
Sequence:CCGGCCCTCATAGTTGGGTTCATTTCTCGAGAAATGAACCCAACTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-553s21c1
Sequence:CCGGGACGCCTGGAGTTTCACATTACTCGAGTAATGTGAAACTCCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178658.4-2690s21c1
Sequence:CCGGCTTGAATGCATGAGATCAAATCTCGAGATTTGATCTCATGCATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-440s21c1
Sequence:CCGGCCAGACGGAGCTGGACAAATTCTCGAGAATTTGTCCAGCTCCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-1976s21c1
Sequence:CCGGTGAATGAGACAACCGTGATTTCTCGAGAAATCACGGTTGTCTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.3-1898s1c1
Sequence:CCGGGAACCAAGAAGTCACTCACTTCTCGAGAAGTGAGTGACTTCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.3-1833s1c1
Sequence:CCGGGCCTTCAATGGACTCTTCCTTCTCGAGAAGGAAGAGTCCATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178658
FAM65B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 65, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215873    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178658.4-2690s1c1
Sequence:CCGGCTTGAATGCATGAGATCAAATCTCGAGATTTGATCTCATGCATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.4-455s1c1
Sequence:CCGGCAAATTGACTGCTCAATTAAACTCGAGTTTAATTGAGCAGTCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-934s21c1
Sequence:CCGGCCCTCATAGTTGGGTTCATTTCTCGAGAAATGAACCCAACTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-553s21c1
Sequence:CCGGGACGCCTGGAGTTTCACATTACTCGAGTAATGTGAAACTCCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178658.4-2690s21c1
Sequence:CCGGCTTGAATGCATGAGATCAAATCTCGAGATTTGATCTCATGCATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-440s21c1
Sequence:CCGGCCAGACGGAGCTGGACAAATTCTCGAGAATTTGTCCAGCTCCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-1976s21c1
Sequence:CCGGTGAATGAGACAACCGTGATTTCTCGAGAAATCACGGTTGTCTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.3-1898s1c1
Sequence:CCGGGAACCAAGAAGTCACTCACTTCTCGAGAAGTGAGTGACTTCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.3-1833s1c1
Sequence:CCGGGCCTTCAATGGACTCTTCCTTCTCGAGAAGGAAGAGTCCATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178658
FAM65B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 65, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215873    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178658.4-2690s1c1
Sequence:CCGGCTTGAATGCATGAGATCAAATCTCGAGATTTGATCTCATGCATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.4-455s1c1
Sequence:CCGGCAAATTGACTGCTCAATTAAACTCGAGTTTAATTGAGCAGTCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-934s21c1
Sequence:CCGGCCCTCATAGTTGGGTTCATTTCTCGAGAAATGAACCCAACTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-553s21c1
Sequence:CCGGGACGCCTGGAGTTTCACATTACTCGAGTAATGTGAAACTCCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178658.4-2690s21c1
Sequence:CCGGCTTGAATGCATGAGATCAAATCTCGAGATTTGATCTCATGCATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-440s21c1
Sequence:CCGGCCAGACGGAGCTGGACAAATTCTCGAGAATTTGTCCAGCTCCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178658.4-1976s21c1
Sequence:CCGGTGAATGAGACAACCGTGATTTCTCGAGAAATCACGGTTGTCTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.3-1898s1c1
Sequence:CCGGGAACCAAGAAGTCACTCACTTCTCGAGAAGTGAGTGACTTCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178658.3-1833s1c1
Sequence:CCGGGCCTTCAATGGACTCTTCCTTCTCGAGAAGGAAGAGTCCATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks