EMAIL THIS PAGE TO A FRIEND

FAM65C

family with sequence similarity 65, member C

59 Gene Product Result for
Synonyms: C20orf175 C20orf176 dJ530I15.2 dJ530I15.3
UniProtKB ID: Q96MK2, Q5QPB6, Q9NQQ2
Gene ID:
Mouse(69553) family with sequence similarity 65, member C
Rat(688510) family with sequence similarity 65, member C
sheep(101118467) family with sequence similarity 65, member C
naked mole-rat(101725464) family with sequence similarity 65, member C
domestic guinea pig(100730422) family with sequence similarity 65, member C
chicken(428169) family with sequence similarity 65, member C
cow(516658) family with sequence similarity 65, member C
domestic cat(101099367) family with sequence similarity 65, member C
dog(485925) family with sequence similarity 65, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU177941 MISSION® esiRNA esiRNA targeting mouse Fam65c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080829 Rosetta Predictions human pricing
XM_001067223 Rosetta Predictions rat pricing
NM_001080708 Rosetta Predictions mouse pricing
XM_149252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233573 predicted 425
2 SASI_Hs01_00233574 predicted 1162
3 SASI_Hs02_00362613 predicted 2960
4 SASI_Hs01_00233577 predicted 1209
5 SASI_Hs02_00362614 predicted 2302
6 SASI_Hs02_00362615 predicted 650
7 SASI_Hs02_00362616 predicted 2264
8 SASI_Hs01_00233580 predicted 1107
9 SASI_Hs02_00362617 predicted 1381
10 SASI_Hs02_00362618 predicted 2329
11 SASI_Hs01_00233571 predicted 1161
12 SASI_Hs01_00233572 predicted 1447
13 SASI_Hs01_00233575 predicted 918
14 SASI_Hs01_00233576 predicted 2061
15 SASI_Hs01_00233578 predicted 702
16 SASI_Hs01_00233579 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320302 predicted 990
2 SASI_Rn02_00320303 predicted 847
3 SASI_Rn02_00320304 predicted 321
4 SASI_Rn02_00320305 predicted 803
5 SASI_Rn02_00320306 predicted 1809
6 SASI_Rn02_00320307 predicted 1566
7 SASI_Rn02_00320308 predicted 905
8 SASI_Rn02_00320309 predicted 1831
9 SASI_Rn02_00320310 predicted 1861
10 SASI_Rn02_00320311 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293543 predicted 2595
2 SASI_Mm02_00293544 predicted 921
3 SASI_Mm02_00293545 predicted 1132
4 SASI_Mm02_00293546 predicted 2086
5 SASI_Mm02_00293547 predicted 2631
6 SASI_Mm02_00293548 predicted 1751
7 SASI_Mm02_00293549 predicted 2702
8 SASI_Mm02_00293550 predicted 2426
9 SASI_Mm02_00293551 predicted 784
10 SASI_Mm02_00293552 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283084 predicted 863
2 SASI_Mm01_00283085 predicted 950
3 SASI_Mm01_00283086 predicted 1166
4 SASI_Mm01_00283087 predicted 1308
5 SASI_Mm01_00283088 predicted 1010
6 SASI_Mm01_00283089 predicted 2031
7 SASI_Mm01_00283090 predicted 1780
8 SASI_Mm01_00283091 predicted 820
9 SASI_Mm01_00283092 predicted 855
10 SASI_Mm01_00283093 predicted 1828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080829
FAM65C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 65, member C
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-531s1c1
Sequence:CCGGCCAGCAGGTGAAGAAGATCTTCTCGAGAAGATCTTCTTCACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-420s1c1
Sequence:CCGGGAGGATCGCAAAGTCCATCAACTCGAGTTGATGGACTTTGCGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-1095s1c1
Sequence:CCGGGCATGAGAACCTGGACATCAACTCGAGTTGATGTCCAGGTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-711s1c1
Sequence:CCGGGATGGAGTTTCACATCAGCAACTCGAGTTGCTGATGTGAAACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-2205s1c1
Sequence:CCGGGCTCAGCTCTTGTCACTCTATCTCGAGATAGAGTGACAAGAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-700s1c1
Sequence:CCGGCACATTCGGAAGATGGAGTTTCTCGAGAAACTCCATCTTCCGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080829
FAM65C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 65, member C
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-531s1c1
Sequence:CCGGCCAGCAGGTGAAGAAGATCTTCTCGAGAAGATCTTCTTCACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-420s1c1
Sequence:CCGGGAGGATCGCAAAGTCCATCAACTCGAGTTGATGGACTTTGCGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-1095s1c1
Sequence:CCGGGCATGAGAACCTGGACATCAACTCGAGTTGATGTCCAGGTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-711s1c1
Sequence:CCGGGATGGAGTTTCACATCAGCAACTCGAGTTGCTGATGTGAAACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-2205s1c1
Sequence:CCGGGCTCAGCTCTTGTCACTCTATCTCGAGATAGAGTGACAAGAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-700s1c1
Sequence:CCGGCACATTCGGAAGATGGAGTTTCTCGAGAAACTCCATCTTCCGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080829
FAM65C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 65, member C
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-531s1c1
Sequence:CCGGCCAGCAGGTGAAGAAGATCTTCTCGAGAAGATCTTCTTCACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-420s1c1
Sequence:CCGGGAGGATCGCAAAGTCCATCAACTCGAGTTGATGGACTTTGCGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-1095s1c1
Sequence:CCGGGCATGAGAACCTGGACATCAACTCGAGTTGATGTCCAGGTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-711s1c1
Sequence:CCGGGATGGAGTTTCACATCAGCAACTCGAGTTGCTGATGTGAAACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-2205s1c1
Sequence:CCGGGCTCAGCTCTTGTCACTCTATCTCGAGATAGAGTGACAAGAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080829.1-700s1c1
Sequence:CCGGCACATTCGGAAGATGGAGTTTCTCGAGAAACTCCATCTTCCGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080708
FAM65C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 65, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-1089s21c1
Sequence:CCGGCAGGAAGGGTTCCCTATATACCTCGAGGTATATAGGGAACCCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-2635s21c1
Sequence:CCGGTACTACACTAATGCCTTAAATCTCGAGATTTAAGGCATTAGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-1799s21c1
Sequence:CCGGGTGATGAACTGTCCCTGTTTGCTCGAGCAAACAGGGACAGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-827s21c1
Sequence:CCGGACGAAGAGGAGAGGGTGTTTGCTCGAGCAAACACCCTCTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-175s21c1
Sequence:CCGGCAAAGCCGAAGGCTCTCAAAGCTCGAGCTTTGAGAGCCTTCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080708
FAM65C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 65, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-1089s21c1
Sequence:CCGGCAGGAAGGGTTCCCTATATACCTCGAGGTATATAGGGAACCCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-2635s21c1
Sequence:CCGGTACTACACTAATGCCTTAAATCTCGAGATTTAAGGCATTAGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-1799s21c1
Sequence:CCGGGTGATGAACTGTCCCTGTTTGCTCGAGCAAACAGGGACAGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-827s21c1
Sequence:CCGGACGAAGAGGAGAGGGTGTTTGCTCGAGCAAACACCCTCTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-175s21c1
Sequence:CCGGCAAAGCCGAAGGCTCTCAAAGCTCGAGCTTTGAGAGCCTTCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080708
FAM65C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 65, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-1089s21c1
Sequence:CCGGCAGGAAGGGTTCCCTATATACCTCGAGGTATATAGGGAACCCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-2635s21c1
Sequence:CCGGTACTACACTAATGCCTTAAATCTCGAGATTTAAGGCATTAGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-1799s21c1
Sequence:CCGGGTGATGAACTGTCCCTGTTTGCTCGAGCAAACAGGGACAGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-827s21c1
Sequence:CCGGACGAAGAGGAGAGGGTGTTTGCTCGAGCAAACACCCTCTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080708.2-175s21c1
Sequence:CCGGCAAAGCCGAAGGCTCTCAAAGCTCGAGCTTTGAGAGCCTTCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks