EMAIL THIS PAGE TO A FRIEND

FAM69A

family with sequence similarity 69, member A

61 Gene Product Result for
UniProtKB ID: Q5T7M9, Q6IRV2
Gene ID:
Human(388650) Summary: This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(67266) family with sequence similarity 69, member A
Rat(360906) family with sequence similarity 69, member A
Zebrafish(678606) family with sequence similarity 69, member A
cow(541171) family with sequence similarity 69, member A
domestic cat(101087082) family with sequence similarity 69, member A
dog(490155) family with sequence similarity 69, member A
chicken(429087) family with sequence similarity 69, member A
domestic guinea pig(100722677) family with sequence similarity 69, member A
naked mole-rat(101712110) family with sequence similarity 69, member A
sheep(101104442) family with sequence similarity 69, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026062 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026062 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026062 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001006605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006605 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006605 Rosetta Predictions human pricing
XM_001060943 Rosetta Predictions rat pricing
XM_341181 Rosetta Predictions rat pricing
NM_026062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305070 predicted 759
2 SASI_Hs02_00305071 predicted 486
3 SASI_Hs01_00064422 predicted 401
4 SASI_Hs01_00064424 predicted 279
5 SASI_Hs01_00064425 predicted 313
6 SASI_Hs02_00305072 predicted 769
7 SASI_Hs02_00305073 predicted 859
8 SASI_Hs02_00305074 predicted 537
9 SASI_Hs01_00064428 predicted 387
10 SASI_Hs02_00305075 predicted 1102
11 SASI_Hs01_00064420 predicted 237
12 SASI_Hs01_00064421 predicted 248
13 SASI_Hs01_00064423 predicted 310
14 SASI_Hs01_00064426 predicted 280
15 SASI_Hs01_00064427 predicted 313
16 SASI_Hs01_00064429 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298197 predicted 1540
2 SASI_Rn02_00298198 predicted 1574
3 SASI_Rn02_00298199 predicted 401
4 SASI_Rn02_00298200 predicted 956
5 SASI_Rn02_00298201 predicted 556
6 SASI_Rn02_00298202 predicted 1460
7 SASI_Rn02_00298203 predicted 1074
8 SASI_Rn02_00298204 predicted 1132
9 SASI_Rn02_00298205 predicted 972
10 SASI_Rn02_00298206 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392543 predicted 1537
2 SASI_Rn02_00392544 predicted 1566
3 SASI_Rn02_00392545 predicted 946
4 SASI_Rn02_00392546 predicted 667
5 SASI_Rn02_00392547 predicted 550
6 SASI_Rn02_00392548 predicted 1460
7 SASI_Rn02_00392549 predicted 1069
8 SASI_Rn02_00392550 predicted 1121
9 SASI_Rn02_00392551 predicted 972
10 SASI_Rn02_00392552 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047105 predicted 707
2 SASI_Mm02_00329602 predicted 344
3 SASI_Mm01_00047106 predicted 378
4 SASI_Mm01_00047107 predicted 727
5 SASI_Mm01_00047108 predicted 319
6 SASI_Mm01_00047109 predicted 984
7 SASI_Mm01_00047110 predicted 527
8 SASI_Mm01_00047111 predicted 1209
9 SASI_Mm01_00047112 predicted 708
10 SASI_Mm01_00047113 predicted 827
11 SASI_Mm01_00047114 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026062
VALIDATED
FAM69A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 69, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-746s21c1
Sequence:CCGGATAAGTCTACCATGGGTTATGCTCGAGCATAACCCATGGTAGACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-333s21c1
Sequence:CCGGATTTAGGAGTTTGGGATAATCCTCGAGGATTATCCCAAACTCCTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.3-1305s1c1
Sequence:CCGGCAAATGACTCTTAGTTCATTTCTCGAGAAATGAACTAAGAGTCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.3-990s1c1
Sequence:CCGGCAAACCTAAAGGAACTTATTACTCGAGTAATAAGTTCCTTTAGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026062.3-1906s1c1
Sequence:CCGGCATCTTAGTATCGTCACATTACTCGAGTAATGTGACGATACTAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-143s21c1
Sequence:CCGGGTCGGAAGCTGGATCATATATCTCGAGATATATGATCCAGCTTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026062.3-2083s21c1
Sequence:CCGGTCTGGGATGAAGGGCTATTTACTCGAGTAAATAGCCCTTCATCCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-790s21c1
Sequence:CCGGCAGAAGGAGCATGGATCAATTCTCGAGAATTGATCCATGCTCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.2-318s1c1
Sequence:CCGGCCCAGCAACCAGATGTATTTACTCGAGTAAATACATCTGGTTGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026062
VALIDATED
FAM69A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 69, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-746s21c1
Sequence:CCGGATAAGTCTACCATGGGTTATGCTCGAGCATAACCCATGGTAGACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-333s21c1
Sequence:CCGGATTTAGGAGTTTGGGATAATCCTCGAGGATTATCCCAAACTCCTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.3-1305s1c1
Sequence:CCGGCAAATGACTCTTAGTTCATTTCTCGAGAAATGAACTAAGAGTCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.3-990s1c1
Sequence:CCGGCAAACCTAAAGGAACTTATTACTCGAGTAATAAGTTCCTTTAGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026062.3-1906s1c1
Sequence:CCGGCATCTTAGTATCGTCACATTACTCGAGTAATGTGACGATACTAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-143s21c1
Sequence:CCGGGTCGGAAGCTGGATCATATATCTCGAGATATATGATCCAGCTTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026062.3-2083s21c1
Sequence:CCGGTCTGGGATGAAGGGCTATTTACTCGAGTAAATAGCCCTTCATCCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-790s21c1
Sequence:CCGGCAGAAGGAGCATGGATCAATTCTCGAGAATTGATCCATGCTCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.2-318s1c1
Sequence:CCGGCCCAGCAACCAGATGTATTTACTCGAGTAAATACATCTGGTTGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026062
VALIDATED
FAM69A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 69, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-746s21c1
Sequence:CCGGATAAGTCTACCATGGGTTATGCTCGAGCATAACCCATGGTAGACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-333s21c1
Sequence:CCGGATTTAGGAGTTTGGGATAATCCTCGAGGATTATCCCAAACTCCTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.3-1305s1c1
Sequence:CCGGCAAATGACTCTTAGTTCATTTCTCGAGAAATGAACTAAGAGTCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.3-990s1c1
Sequence:CCGGCAAACCTAAAGGAACTTATTACTCGAGTAATAAGTTCCTTTAGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026062.3-1906s1c1
Sequence:CCGGCATCTTAGTATCGTCACATTACTCGAGTAATGTGACGATACTAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-143s21c1
Sequence:CCGGGTCGGAAGCTGGATCATATATCTCGAGATATATGATCCAGCTTCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026062.3-2083s21c1
Sequence:CCGGTCTGGGATGAAGGGCTATTTACTCGAGTAAATAGCCCTTCATCCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026062.3-790s21c1
Sequence:CCGGCAGAAGGAGCATGGATCAATTCTCGAGAATTGATCCATGCTCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026062.2-318s1c1
Sequence:CCGGCCCAGCAACCAGATGTATTTACTCGAGTAAATACATCTGGTTGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006605
VALIDATED
FAM69A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 69, member A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006605.1-250s1c1
Sequence:CCGGCCTGCATGTAACAGCCTTTGTCTCGAGACAAAGGCTGTTACATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-57s1c1
Sequence:CCGGGCTAAGGAAACCCTATTACCTCTCGAGAGGTAATAGGGTTTCCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-189s1c1
Sequence:CCGGCAGAGGAAAGGACTGTAAGAACTCGAGTTCTTACAGTCCTTTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006605.1-253s1c1
Sequence:CCGGGCATGTAACAGCCTTTGTGTTCTCGAGAACACAAAGGCTGTTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006605.1-220s1c1
Sequence:CCGGGACAAGTACAAGACTGGAGTTCTCGAGAACTCCAGTCTTGTACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-87s1c1
Sequence:CCGGCTTCTCATATGTGCGGATGAACTCGAGTTCATCCGCACATATGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-370s1c1
Sequence:CCGGCAAATGGAACAAGCGCTTCATCTCGAGATGAAGCGCTTGTTCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-146s1c1
Sequence:CCGGGCTGGATTATATATGTGCAGTCTCGAGACTGCACATATATAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-430s1c1
Sequence:CCGGGTGCTATTTGATAAGCCAACTCTCGAGAGTTGGCTTATCAAATAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-401s1c1
Sequence:CCGGGAACTGAATTGGAACCAAGAACTCGAGTTCTTGGTTCCAATTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-222s1c1
Sequence:CCGGCAAGTACAAGACTGGAGTTATCTCGAGATAACTCCAGTCTTGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006605
VALIDATED
FAM69A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 69, member A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006605.1-250s1c1
Sequence:CCGGCCTGCATGTAACAGCCTTTGTCTCGAGACAAAGGCTGTTACATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-57s1c1
Sequence:CCGGGCTAAGGAAACCCTATTACCTCTCGAGAGGTAATAGGGTTTCCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-189s1c1
Sequence:CCGGCAGAGGAAAGGACTGTAAGAACTCGAGTTCTTACAGTCCTTTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006605.1-253s1c1
Sequence:CCGGGCATGTAACAGCCTTTGTGTTCTCGAGAACACAAAGGCTGTTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006605.1-220s1c1
Sequence:CCGGGACAAGTACAAGACTGGAGTTCTCGAGAACTCCAGTCTTGTACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-87s1c1
Sequence:CCGGCTTCTCATATGTGCGGATGAACTCGAGTTCATCCGCACATATGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-370s1c1
Sequence:CCGGCAAATGGAACAAGCGCTTCATCTCGAGATGAAGCGCTTGTTCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-146s1c1
Sequence:CCGGGCTGGATTATATATGTGCAGTCTCGAGACTGCACATATATAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-430s1c1
Sequence:CCGGGTGCTATTTGATAAGCCAACTCTCGAGAGTTGGCTTATCAAATAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-401s1c1
Sequence:CCGGGAACTGAATTGGAACCAAGAACTCGAGTTCTTGGTTCCAATTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-222s1c1
Sequence:CCGGCAAGTACAAGACTGGAGTTATCTCGAGATAACTCCAGTCTTGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006605
VALIDATED
FAM69A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 69, member A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006605.1-250s1c1
Sequence:CCGGCCTGCATGTAACAGCCTTTGTCTCGAGACAAAGGCTGTTACATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-57s1c1
Sequence:CCGGGCTAAGGAAACCCTATTACCTCTCGAGAGGTAATAGGGTTTCCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-189s1c1
Sequence:CCGGCAGAGGAAAGGACTGTAAGAACTCGAGTTCTTACAGTCCTTTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006605.1-253s1c1
Sequence:CCGGGCATGTAACAGCCTTTGTGTTCTCGAGAACACAAAGGCTGTTACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006605.1-220s1c1
Sequence:CCGGGACAAGTACAAGACTGGAGTTCTCGAGAACTCCAGTCTTGTACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-87s1c1
Sequence:CCGGCTTCTCATATGTGCGGATGAACTCGAGTTCATCCGCACATATGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-370s1c1
Sequence:CCGGCAAATGGAACAAGCGCTTCATCTCGAGATGAAGCGCTTGTTCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-146s1c1
Sequence:CCGGGCTGGATTATATATGTGCAGTCTCGAGACTGCACATATATAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-430s1c1
Sequence:CCGGGTGCTATTTGATAAGCCAACTCTCGAGAGTTGGCTTATCAAATAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006605.1-401s1c1
Sequence:CCGGGAACTGAATTGGAACCAAGAACTCGAGTTCTTGGTTCCAATTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006605.1-222s1c1
Sequence:CCGGCAAGTACAAGACTGGAGTTATCTCGAGATAACTCCAGTCTTGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)