EMAIL THIS PAGE TO A FRIEND

FAM69B

family with sequence similarity 69, member B

52 Gene Product Result for
Synonyms: C9orf136 pp6977
UniProtKB ID: Q5VUD6, Q5VUD7, Q8N5N0, Q8WYU5
Gene ID:
Human(138311) Summary: This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. [provided by RefSeq, Nov 2011]
Mouse(56279) family with sequence similarity 69, member B
Rat(362090) family with sequence similarity 69, member B
sheep(101114262) family with sequence similarity 69, member B
naked mole-rat(101707580) family with sequence similarity 69, member B
domestic guinea pig(100725398) family with sequence similarity 69, member B
Zebrafish(567731) family with sequence similarity 69, member B
dog(491248) family with sequence similarity 69, member B
domestic cat(101094888) family with sequence similarity 69, member B
cow(539229) family with sequence similarity 69, member B
chicken(417139) family with sequence similarity 69, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152421 Rosetta Predictions human pricing
NM_001014178 Rosetta Predictions rat pricing
NM_019833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208770 predicted 1132
2 SASI_Hs01_00208771 predicted 1186
3 SASI_Hs01_00208772 predicted 941
4 SASI_Hs01_00208773 predicted 543
5 SASI_Hs01_00208775 predicted 953
6 SASI_Hs01_00208776 predicted 964
7 SASI_Hs01_00208777 predicted 993
8 SASI_Hs02_00366153 predicted 1304
9 SASI_Hs01_00208778 predicted 421
10 SASI_Hs01_00208779 predicted 664
11 SASI_Hs01_00208774 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078659 predicted 900
2 SASI_Rn01_00078662 predicted 1321
3 SASI_Rn01_00078663 predicted 941
4 SASI_Rn02_00201676 predicted 587
5 SASI_Rn01_00078664 predicted 1151
6 SASI_Rn02_00201677 predicted 535
7 SASI_Rn02_00201678 predicted 640
8 SASI_Rn02_00201679 predicted 421
9 SASI_Rn01_00078666 predicted 954
10 SASI_Rn02_00201680 predicted 254
11 SASI_Rn01_00078660 predicted 862
12 SASI_Rn01_00078661 predicted 346
13 SASI_Rn01_00078665 predicted 692
14 SASI_Rn01_00078667 predicted 457
15 SASI_Rn01_00078668 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061605 predicted 513
2 SASI_Mm01_00061606 predicted 365
3 SASI_Mm01_00061607 predicted 778
4 SASI_Mm01_00061609 predicted 1045
5 SASI_Mm02_00325134 predicted 305
6 SASI_Mm01_00061610 predicted 526
7 SASI_Mm01_00061611 predicted 1095
8 SASI_Mm01_00061612 predicted 693
9 SASI_Mm01_00061613 predicted 1058
10 SASI_Mm01_00061614 predicted 316
11 SASI_Mm01_00061608 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152421
FAM69B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 69, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152421.2-1354s1c1
Sequence:CCGGGAAGAAGATCTCCAACACCAACTCGAGTTGGTGTTGGAGATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1447s1c1
Sequence:CCGGCCTCAAGGAATCCTGTCAGAACTCGAGTTCTGACAGGATTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152421.2-425s1c1
Sequence:CCGGGTAACCATCAAGTGTGGCATTCTCGAGAATGCCACACTTGATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1468s1c1
Sequence:CCGGGATGTGAAATGCAACTGTGTTCTCGAGAACACAGTTGCATTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152421.2-1357s1c1
Sequence:CCGGGAAGATCTCCAACACCAAGTACTCGAGTACTTGGTGTTGGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1473s1c1
Sequence:CCGGGAAATGCAACTGTGTTGCAAACTCGAGTTTGCAACACAGTTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152421.3-953s21c1
Sequence:CCGGCACGGCTCTTACGGGACTTTCCTCGAGGAAAGTCCCGTAAGAGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152421.3-1006s21c1
Sequence:CCGGCTACACAGCCACCTACGACTTCTCGAGAAGTCGTAGGTGGCTGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152421
FAM69B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 69, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152421.2-1354s1c1
Sequence:CCGGGAAGAAGATCTCCAACACCAACTCGAGTTGGTGTTGGAGATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1447s1c1
Sequence:CCGGCCTCAAGGAATCCTGTCAGAACTCGAGTTCTGACAGGATTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152421.2-425s1c1
Sequence:CCGGGTAACCATCAAGTGTGGCATTCTCGAGAATGCCACACTTGATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1468s1c1
Sequence:CCGGGATGTGAAATGCAACTGTGTTCTCGAGAACACAGTTGCATTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152421.2-1357s1c1
Sequence:CCGGGAAGATCTCCAACACCAAGTACTCGAGTACTTGGTGTTGGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1473s1c1
Sequence:CCGGGAAATGCAACTGTGTTGCAAACTCGAGTTTGCAACACAGTTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152421.3-953s21c1
Sequence:CCGGCACGGCTCTTACGGGACTTTCCTCGAGGAAAGTCCCGTAAGAGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152421.3-1006s21c1
Sequence:CCGGCTACACAGCCACCTACGACTTCTCGAGAAGTCGTAGGTGGCTGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152421
FAM69B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 69, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152421.2-1354s1c1
Sequence:CCGGGAAGAAGATCTCCAACACCAACTCGAGTTGGTGTTGGAGATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1447s1c1
Sequence:CCGGCCTCAAGGAATCCTGTCAGAACTCGAGTTCTGACAGGATTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152421.2-425s1c1
Sequence:CCGGGTAACCATCAAGTGTGGCATTCTCGAGAATGCCACACTTGATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1468s1c1
Sequence:CCGGGATGTGAAATGCAACTGTGTTCTCGAGAACACAGTTGCATTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152421.2-1357s1c1
Sequence:CCGGGAAGATCTCCAACACCAAGTACTCGAGTACTTGGTGTTGGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152421.2-1473s1c1
Sequence:CCGGGAAATGCAACTGTGTTGCAAACTCGAGTTTGCAACACAGTTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152421.3-953s21c1
Sequence:CCGGCACGGCTCTTACGGGACTTTCCTCGAGGAAAGTCCCGTAAGAGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152421.3-1006s21c1
Sequence:CCGGCTACACAGCCACCTACGACTTCTCGAGAAGTCGTAGGTGGCTGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019833
VALIDATED
FAM69B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 69, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-652s1c1
Sequence:CCGGCCTCAAGGCTAACTTAGGAGACTCGAGTCTCCTAAGTTAGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-503s1c1
Sequence:CCGGGACAAAGAGGTGACCATCAAACTCGAGTTTGATGGTCACCTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-646s1c1
Sequence:CCGGCAGCTTCCTCAAGGCTAACTTCTCGAGAAGTTAGCCTTGAGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019833.1-856s1c1
Sequence:CCGGCCTCTATCTTACTGAGGGCATCTCGAGATGCCCTCAGTAAGATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-717s1c1
Sequence:CCGGCGGACTTCAACAAGGATAGCACTCGAGTGCTATCCTTGTTGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-1025s1c1
Sequence:CCGGGAGCTCTTCCATGGTTCCTATCTCGAGATAGGAACCATGGAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019833.1-1087s1c1
Sequence:CCGGGTACACAGCTACCTACGACTTCTCGAGAAGTCGTAGGTAGCTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-1060s1c1
Sequence:CCGGGTGTGAGACTACACTTGCCAACTCGAGTTGGCAAGTGTAGTCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-660s1c1
Sequence:CCGGCTAACTTAGGAGACCTGCCTTCTCGAGAAGGCAGGTCTCCTAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019833
VALIDATED
FAM69B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 69, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-652s1c1
Sequence:CCGGCCTCAAGGCTAACTTAGGAGACTCGAGTCTCCTAAGTTAGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-503s1c1
Sequence:CCGGGACAAAGAGGTGACCATCAAACTCGAGTTTGATGGTCACCTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-646s1c1
Sequence:CCGGCAGCTTCCTCAAGGCTAACTTCTCGAGAAGTTAGCCTTGAGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019833.1-856s1c1
Sequence:CCGGCCTCTATCTTACTGAGGGCATCTCGAGATGCCCTCAGTAAGATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-717s1c1
Sequence:CCGGCGGACTTCAACAAGGATAGCACTCGAGTGCTATCCTTGTTGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-1025s1c1
Sequence:CCGGGAGCTCTTCCATGGTTCCTATCTCGAGATAGGAACCATGGAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019833.1-1087s1c1
Sequence:CCGGGTACACAGCTACCTACGACTTCTCGAGAAGTCGTAGGTAGCTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-1060s1c1
Sequence:CCGGGTGTGAGACTACACTTGCCAACTCGAGTTGGCAAGTGTAGTCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-660s1c1
Sequence:CCGGCTAACTTAGGAGACCTGCCTTCTCGAGAAGGCAGGTCTCCTAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019833
VALIDATED
FAM69B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 69, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-652s1c1
Sequence:CCGGCCTCAAGGCTAACTTAGGAGACTCGAGTCTCCTAAGTTAGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-503s1c1
Sequence:CCGGGACAAAGAGGTGACCATCAAACTCGAGTTTGATGGTCACCTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-646s1c1
Sequence:CCGGCAGCTTCCTCAAGGCTAACTTCTCGAGAAGTTAGCCTTGAGGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019833.1-856s1c1
Sequence:CCGGCCTCTATCTTACTGAGGGCATCTCGAGATGCCCTCAGTAAGATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-717s1c1
Sequence:CCGGCGGACTTCAACAAGGATAGCACTCGAGTGCTATCCTTGTTGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019833.1-1025s1c1
Sequence:CCGGGAGCTCTTCCATGGTTCCTATCTCGAGATAGGAACCATGGAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019833.1-1087s1c1
Sequence:CCGGGTACACAGCTACCTACGACTTCTCGAGAAGTCGTAGGTAGCTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-1060s1c1
Sequence:CCGGGTGTGAGACTACACTTGCCAACTCGAGTTGGCAAGTGTAGTCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019833.1-660s1c1
Sequence:CCGGCTAACTTAGGAGACCTGCCTTCTCGAGAAGGCAGGTCTCCTAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks