EMAIL THIS PAGE TO A FRIEND

FAM69C

family with sequence similarity 69, member C

59 Gene Product Result for
Synonyms: C18orf51
UniProtKB ID: Q0P6D2
Gene ID:
Human(125704) Summary: This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. [provided by RefSeq, Nov 2011]
Mouse(240479) family with sequence similarity 69, member C
Rat(498891) family with sequence similarity 69, member C
Zebrafish(336057) family with sequence similarity 69, member C
dog(608630) family with sequence similarity 69, member C
domestic cat(101099250) family with sequence similarity 69, member C
cow(517668) family with sequence similarity 69, member C
chicken(421014) family with sequence similarity 69, member C
domestic guinea pig(100729894) family with sequence similarity 69, member C
naked mole-rat(101722272) family with sequence similarity 69, member C
sheep(101111509) family with sequence similarity 69, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001044369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001044369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001044369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012351 MISSION® esiRNA esiRNA targeting human C18orf51 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001044369 Rosetta Predictions human pricing
XM_058931 Rosetta Predictions human pricing
XM_001061354 Rosetta Predictions rat pricing
XM_574179 Rosetta Predictions rat pricing
NM_173770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311312 predicted 500
2 SASI_Hs02_00311313 predicted 281
3 SASI_Hs02_00311314 predicted 240
4 SASI_Hs02_00311315 predicted 373
5 SASI_Hs02_00311316 predicted 317
6 SASI_Hs02_00311317 predicted 556
7 SASI_Hs02_00311318 predicted 241
8 SASI_Hs02_00311319 predicted 273
9 SASI_Hs02_00311320 predicted 244
10 SASI_Hs02_00311321 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_058931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296754 predicted 1219
2 SASI_Hs01_00296755 predicted 1272
3 SASI_Hs01_00296756 predicted 1257
4 SASI_Hs01_00296757 predicted 1272
5 SASI_Hs01_00296758 predicted 1393
6 SASI_Hs01_00296759 predicted 441
7 SASI_Hs01_00296760 predicted 990
8 SASI_Hs01_00296761 predicted 969
9 SASI_Hs01_00296762 predicted 948
10 SASI_Hs01_00296763 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299736 predicted 946
2 SASI_Rn02_00299737 predicted 971
3 SASI_Rn02_00299738 predicted 790
4 SASI_Rn02_00299739 predicted 747
5 SASI_Rn02_00299740 predicted 649
6 SASI_Rn02_00299741 predicted 339
7 SASI_Rn02_00299742 predicted 344
8 SASI_Rn02_00299743 predicted 983
9 SASI_Rn02_00299744 predicted 286
10 SASI_Rn02_00299745 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401553 predicted 948
2 SASI_Rn02_00401554 predicted 974
3 SASI_Rn02_00401555 predicted 790
4 SASI_Rn02_00401556 predicted 744
5 SASI_Rn02_00401557 predicted 651
6 SASI_Rn02_00401558 predicted 345
7 SASI_Rn02_00401559 predicted 340
8 SASI_Rn02_00401560 predicted 981
9 SASI_Rn02_00401561 predicted 283
10 SASI_Rn02_00401562 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102234 predicted 997
2 SASI_Mm01_00102235 predicted 1225
3 SASI_Mm01_00102237 predicted 1587
4 SASI_Mm01_00102238 predicted 1024
5 SASI_Mm02_00345423 predicted 1076
6 SASI_Mm01_00102239 predicted 789
7 SASI_Mm01_00102240 predicted 990
8 SASI_Mm01_00102241 predicted 696
9 SASI_Mm01_00102242 predicted 1541
10 SASI_Mm01_00102243 predicted 961
11 SASI_Mm01_00102236 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001044369
FAM69C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 69, member C
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-1267s21c1
Sequence:CCGGTAGCCACTCTCTGGCCTTAAACTCGAGTTTAAGGCCAGAGAGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-998s21c1
Sequence:CCGGGTGATTTACGAGTCAACAAATCTCGAGATTTGTTGACTCGTAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-789s21c1
Sequence:CCGGCTTGGACATGGTGAACCATTTCTCGAGAAATGGTTCACCATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044369.2-1612s21c1
Sequence:CCGGGTAAATCGTTACCACGTTAAACTCGAGTTTAACGTGGTAACGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001044369
FAM69C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 69, member C
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-1267s21c1
Sequence:CCGGTAGCCACTCTCTGGCCTTAAACTCGAGTTTAAGGCCAGAGAGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-998s21c1
Sequence:CCGGGTGATTTACGAGTCAACAAATCTCGAGATTTGTTGACTCGTAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-789s21c1
Sequence:CCGGCTTGGACATGGTGAACCATTTCTCGAGAAATGGTTCACCATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044369.2-1612s21c1
Sequence:CCGGGTAAATCGTTACCACGTTAAACTCGAGTTTAACGTGGTAACGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001044369
FAM69C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 69, member C
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-1267s21c1
Sequence:CCGGTAGCCACTCTCTGGCCTTAAACTCGAGTTTAAGGCCAGAGAGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-998s21c1
Sequence:CCGGGTGATTTACGAGTCAACAAATCTCGAGATTTGTTGACTCGTAAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044369.2-789s21c1
Sequence:CCGGCTTGGACATGGTGAACCATTTCTCGAGAAATGGTTCACCATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044369.2-1612s21c1
Sequence:CCGGGTAAATCGTTACCACGTTAAACTCGAGTTTAACGTGGTAACGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173770
FAM69C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 69, member C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173770.4-912s1c1
Sequence:CCGGGACTTTACGGTGGTAGCTATTCTCGAGAATAGCTACCACCGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173770.4-635s1c1
Sequence:CCGGCCAACAGGAGGAATACGTATACTCGAGTATACGTATTCCTCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173770.2-1362s1c1
Sequence:CCGGCCTCCTGTAGTTGCTATGCAACTCGAGTTGCATAGCAACTACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173770.2-1710s1c1
Sequence:CCGGCCATGAGTGTATGAGTGGGTTCTCGAGAACCCACTCATACACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173770.2-793s1c1
Sequence:CCGGGCACAGGCTATTAGCCACATTCTCGAGAATGTGGCTAATAGCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173770.2-1000s1c1
Sequence:CCGGGAAGATTGCAATTTCTTCGATCTCGAGATCGAAGAAATTGCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173770.2-1782s1c1
Sequence:CCGGGCATGGGATTGTGTGTATGTACTCGAGTACATACACACAATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173770
FAM69C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 69, member C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173770.4-912s1c1
Sequence:CCGGGACTTTACGGTGGTAGCTATTCTCGAGAATAGCTACCACCGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173770.4-635s1c1
Sequence:CCGGCCAACAGGAGGAATACGTATACTCGAGTATACGTATTCCTCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173770.2-1362s1c1
Sequence:CCGGCCTCCTGTAGTTGCTATGCAACTCGAGTTGCATAGCAACTACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173770.2-1710s1c1
Sequence:CCGGCCATGAGTGTATGAGTGGGTTCTCGAGAACCCACTCATACACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173770.2-793s1c1
Sequence:CCGGGCACAGGCTATTAGCCACATTCTCGAGAATGTGGCTAATAGCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173770.2-1000s1c1
Sequence:CCGGGAAGATTGCAATTTCTTCGATCTCGAGATCGAAGAAATTGCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173770.2-1782s1c1
Sequence:CCGGGCATGGGATTGTGTGTATGTACTCGAGTACATACACACAATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173770
FAM69C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 69, member C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173770.4-912s1c1
Sequence:CCGGGACTTTACGGTGGTAGCTATTCTCGAGAATAGCTACCACCGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173770.4-635s1c1
Sequence:CCGGCCAACAGGAGGAATACGTATACTCGAGTATACGTATTCCTCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173770.2-1362s1c1
Sequence:CCGGCCTCCTGTAGTTGCTATGCAACTCGAGTTGCATAGCAACTACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173770.2-1710s1c1
Sequence:CCGGCCATGAGTGTATGAGTGGGTTCTCGAGAACCCACTCATACACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173770.2-793s1c1
Sequence:CCGGGCACAGGCTATTAGCCACATTCTCGAGAATGTGGCTAATAGCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173770.2-1000s1c1
Sequence:CCGGGAAGATTGCAATTTCTTCGATCTCGAGATCGAAGAAATTGCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173770.2-1782s1c1
Sequence:CCGGGCATGGGATTGTGTGTATGTACTCGAGTACATACACACAATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks