EMAIL THIS PAGE TO A FRIEND

FAM71A

family with sequence similarity 71, member A

68 Gene Product Result for
Synonyms: RP11-338C15.4
UniProtKB ID: Q8IYT1, Q5VTZ1
Gene ID:
Mouse(619288) family with sequence similarity 71, member A
Rat(498311) family with sequence similarity 71, member A
sheep(101115812) family with sequence similarity 71, member A
domestic guinea pig(100722096) family with sequence similarity 71, member A
domestic cat(101083232) family with sequence similarity 71, member A
cow(616153) family with sequence similarity 71, member A
dog(490282) family with sequence similarity 71, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001109759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001109759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001109759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153511 MISSION® esiRNA esiRNA human FAM71A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153606 Rosetta Predictions human pricing
NM_001109084 Rosetta Predictions rat pricing
NM_001109759 Rosetta Predictions mouse pricing
XM_886705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122050 predicted 437
2 SASI_Hs01_00122051 predicted 679
3 SASI_Hs01_00122052 predicted 508
4 SASI_Hs01_00122053 predicted 1867
5 SASI_Hs01_00122054 predicted 881
6 SASI_Hs01_00122055 predicted 855
7 SASI_Hs02_00367336 predicted 843
8 SASI_Hs01_00122057 predicted 2062
9 SASI_Hs01_00122058 predicted 601
10 SASI_Hs01_00122059 predicted 528
11 SASI_Hs01_00122056 predicted 1998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244970 predicted 444
2 SASI_Rn02_00244971 predicted 1387
3 SASI_Rn02_00244972 predicted 472
4 SASI_Rn02_00244973 predicted 960
5 SASI_Rn02_00244974 predicted 956
6 SASI_Rn02_00244975 predicted 1375
7 SASI_Rn02_00244976 predicted 1092
8 SASI_Rn02_00244977 predicted 475
9 SASI_Rn02_00244978 predicted 1060
10 SASI_Rn02_00244979 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304324 predicted 520
2 SASI_Mm02_00304325 predicted 1780
3 SASI_Mm02_00304326 predicted 1610
4 SASI_Mm02_00304327 predicted 2001
5 SASI_Mm02_00304328 predicted 728
6 SASI_Mm02_00304329 predicted 1989
7 SASI_Mm02_00304330 predicted 559
8 SASI_Mm02_00304331 predicted 378
9 SASI_Mm02_00304332 predicted 1425
10 SASI_Mm02_00304333 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254210 predicted 1795
2 SASI_Mm01_00254211 predicted 1617
3 SASI_Mm01_00254212 predicted 2001
4 SASI_Mm01_00254213 predicted 1278
5 SASI_Mm01_00254214 predicted 1568
6 SASI_Mm01_00254215 predicted 1986
7 SASI_Mm01_00254216 predicted 1427
8 SASI_Mm01_00254217 predicted 1421
9 SASI_Mm01_00254218 predicted 1763
10 SASI_Mm01_00254219 predicted 1362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153606
FAM71A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-890s1c1
Sequence:CCGGGACCTCTTTGCCTATTGGGAACTCGAGTTCCCAATAGGCAAAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153606.1-844s1c1
Sequence:CCGGCAGATCTTGCTATCTGCAATTCTCGAGAATTGCAGATAGCAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-843s1c1
Sequence:CCGGGCAGATCTTGCTATCTGCAATCTCGAGATTGCAGATAGCAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-744s1c1
Sequence:CCGGCAAAGAACTTAGAGCTCACCACTCGAGTGGTGAGCTCTAAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-797s1c1
Sequence:CCGGGTTCAAGACCATGAGAAACAACTCGAGTTGTTTCTCATGGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-550s1c1
Sequence:CCGGCGACTTTATCCAGATCACCAACTCGAGTTGGTGATCTGGATAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153606.3-2196s21c1
Sequence:CCGGGTGACCTTTGAAGCCCATTAACTCGAGTTAATGGGCTTCAAAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153606.3-1171s21c1
Sequence:CCGGACTTTAACAAACCCACTAATGCTCGAGCATTAGTGGGTTTGTTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153606
FAM71A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-890s1c1
Sequence:CCGGGACCTCTTTGCCTATTGGGAACTCGAGTTCCCAATAGGCAAAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153606.1-844s1c1
Sequence:CCGGCAGATCTTGCTATCTGCAATTCTCGAGAATTGCAGATAGCAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-843s1c1
Sequence:CCGGGCAGATCTTGCTATCTGCAATCTCGAGATTGCAGATAGCAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-744s1c1
Sequence:CCGGCAAAGAACTTAGAGCTCACCACTCGAGTGGTGAGCTCTAAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-797s1c1
Sequence:CCGGGTTCAAGACCATGAGAAACAACTCGAGTTGTTTCTCATGGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-550s1c1
Sequence:CCGGCGACTTTATCCAGATCACCAACTCGAGTTGGTGATCTGGATAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153606.3-2196s21c1
Sequence:CCGGGTGACCTTTGAAGCCCATTAACTCGAGTTAATGGGCTTCAAAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153606.3-1171s21c1
Sequence:CCGGACTTTAACAAACCCACTAATGCTCGAGCATTAGTGGGTTTGTTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153606
FAM71A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-890s1c1
Sequence:CCGGGACCTCTTTGCCTATTGGGAACTCGAGTTCCCAATAGGCAAAGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153606.1-844s1c1
Sequence:CCGGCAGATCTTGCTATCTGCAATTCTCGAGAATTGCAGATAGCAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-843s1c1
Sequence:CCGGGCAGATCTTGCTATCTGCAATCTCGAGATTGCAGATAGCAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-744s1c1
Sequence:CCGGCAAAGAACTTAGAGCTCACCACTCGAGTGGTGAGCTCTAAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-797s1c1
Sequence:CCGGGTTCAAGACCATGAGAAACAACTCGAGTTGTTTCTCATGGTCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153606.1-550s1c1
Sequence:CCGGCGACTTTATCCAGATCACCAACTCGAGTTGGTGATCTGGATAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153606.3-2196s21c1
Sequence:CCGGGTGACCTTTGAAGCCCATTAACTCGAGTTAATGGGCTTCAAAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153606.3-1171s21c1
Sequence:CCGGACTTTAACAAACCCACTAATGCTCGAGCATTAGTGGGTTTGTTAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109759
FAM71A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1421s21c1
Sequence:CCGGAGCAAGTCCTTGGAGTATATTCTCGAGAATATACTCCAAGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1148s21c1
Sequence:CCGGGATTCTCACATATCCACTATTCTCGAGAATAGTGGATATGTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1791s21c1
Sequence:CCGGACAAAGGCAGCAAGCGCAATACTCGAGTATTGCGCTTGCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-2017s21c1
Sequence:CCGGATTAGAGACAACCGACGTAAACTCGAGTTTACGTCGGTTGTCTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-489s21c1
Sequence:CCGGACAAAGGAGAGTATGATATATCTCGAGATATATCATACTCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109759
FAM71A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1421s21c1
Sequence:CCGGAGCAAGTCCTTGGAGTATATTCTCGAGAATATACTCCAAGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1148s21c1
Sequence:CCGGGATTCTCACATATCCACTATTCTCGAGAATAGTGGATATGTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1791s21c1
Sequence:CCGGACAAAGGCAGCAAGCGCAATACTCGAGTATTGCGCTTGCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-2017s21c1
Sequence:CCGGATTAGAGACAACCGACGTAAACTCGAGTTTACGTCGGTTGTCTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-489s21c1
Sequence:CCGGACAAAGGAGAGTATGATATATCTCGAGATATATCATACTCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109759
FAM71A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1421s21c1
Sequence:CCGGAGCAAGTCCTTGGAGTATATTCTCGAGAATATACTCCAAGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1148s21c1
Sequence:CCGGGATTCTCACATATCCACTATTCTCGAGAATAGTGGATATGTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-1791s21c1
Sequence:CCGGACAAAGGCAGCAAGCGCAATACTCGAGTATTGCGCTTGCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-2017s21c1
Sequence:CCGGATTAGAGACAACCGACGTAAACTCGAGTTTACGTCGGTTGTCTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109759.1-489s21c1
Sequence:CCGGACAAAGGAGAGTATGATATATCTCGAGATATATCATACTCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks