EMAIL THIS PAGE TO A FRIEND

FAM71B

family with sequence similarity 71, member B

48 Gene Product Result for
UniProtKB ID: Q8TC56, Q1EDD9, Q8TC64, Q96LY8
Gene ID:
Mouse(432552) family with sequence similarity 71, member B
Rat(497888) family with sequence similarity 71, member B
domestic cat(101090233) family with sequence similarity 71, member B
cow(540409) family with sequence similarity 71, member B
dog(612061) family with sequence similarity 71, member B
domestic guinea pig(100721817) family with sequence similarity 71, member B
naked mole-rat(101710623) family with sequence similarity 71, member B
sheep(101112646) family with sequence similarity 71, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130899 Rosetta Predictions human pricing
NM_001025031 Rosetta Predictions rat pricing
NM_001013783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155179 predicted 445
2 SASI_Hs01_00155180 predicted 390
3 SASI_Hs01_00155182 predicted 232
4 SASI_Hs02_00362911 predicted 1256
5 SASI_Hs01_00155185 predicted 758
6 SASI_Hs01_00155186 predicted 233
7 SASI_Hs01_00155187 predicted 238
8 SASI_Hs01_00155188 predicted 1315
9 SASI_Hs02_00362912 predicted 935
10 SASI_Hs02_00362913 predicted 1317
11 SASI_Hs01_00155181 predicted 1412
12 SASI_Hs01_00155183 predicted 1114
13 SASI_Hs01_00155184 predicted 1667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105533 predicted 221
2 SASI_Rn01_00105534 predicted 1601
3 SASI_Rn01_00105535 predicted 1446
4 SASI_Rn01_00105536 predicted 219
5 SASI_Rn01_00105537 predicted 1852
6 SASI_Rn01_00105538 predicted 206
7 SASI_Rn01_00105539 predicted 399
8 SASI_Rn01_00105540 predicted 1539
9 SASI_Rn01_00105541 predicted 609
10 SASI_Rn01_00105542 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034441 predicted 473
2 SASI_Mm01_00034442 predicted 237
3 SASI_Mm01_00034443 predicted 1311
4 SASI_Mm01_00034444 predicted 223
5 SASI_Mm01_00034446 predicted 1596
6 SASI_Mm01_00034447 predicted 241
7 SASI_Mm01_00034448 predicted 1436
8 SASI_Mm02_00287345 predicted 1550
9 SASI_Mm01_00034449 predicted 219
10 SASI_Mm01_00034450 predicted 1426
11 SASI_Mm01_00034445 predicted 1848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130899
FAM71B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1850s21c1
Sequence:CCGGGAGATGATCAGTGGCACTATGCTCGAGCATAGTGCCACTGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1662s21c1
Sequence:CCGGCATCTAGCACAGGAGCTTTACCTCGAGGTAAAGCTCCTGTGCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1105s21c1
Sequence:CCGGCATATCCTCAGAGGGTATTAGCTCGAGCTAATACCCTCTGAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-1892s1c1
Sequence:CCGGCGGAGATGATCGTCTTTGAAACTCGAGTTTCAAAGACGATCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-467s1c1
Sequence:CCGGCGAGACTGCTTCCCTTGAAATCTCGAGATTTCAAGGGAAGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-986s1c1
Sequence:CCGGCAGGTGCTATGAGCATAGCAACTCGAGTTGCTATGCTCATAGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-1630s1c1
Sequence:CCGGGAGTCGAGAACAACTCAGGAACTCGAGTTCCTGAGTTGTTCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-926s1c1
Sequence:CCGGGAACAGCAACAGGACCTAGAACTCGAGTTCTAGGTCCTGTTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-238s1c1
Sequence:CCGGGCACCAATGTTCGAGAGTAATCTCGAGATTACTCTCGAACATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-239s1c1
Sequence:CCGGCACCAATGTTCGAGAGTAATTCTCGAGAATTACTCTCGAACATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-1902s1c1
Sequence:CCGGCGTCTTTGAAACCAAATCCATCTCGAGATGGATTTGGTTTCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130899
FAM71B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1850s21c1
Sequence:CCGGGAGATGATCAGTGGCACTATGCTCGAGCATAGTGCCACTGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1662s21c1
Sequence:CCGGCATCTAGCACAGGAGCTTTACCTCGAGGTAAAGCTCCTGTGCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1105s21c1
Sequence:CCGGCATATCCTCAGAGGGTATTAGCTCGAGCTAATACCCTCTGAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-1892s1c1
Sequence:CCGGCGGAGATGATCGTCTTTGAAACTCGAGTTTCAAAGACGATCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-467s1c1
Sequence:CCGGCGAGACTGCTTCCCTTGAAATCTCGAGATTTCAAGGGAAGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-986s1c1
Sequence:CCGGCAGGTGCTATGAGCATAGCAACTCGAGTTGCTATGCTCATAGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-1630s1c1
Sequence:CCGGGAGTCGAGAACAACTCAGGAACTCGAGTTCCTGAGTTGTTCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-926s1c1
Sequence:CCGGGAACAGCAACAGGACCTAGAACTCGAGTTCTAGGTCCTGTTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-238s1c1
Sequence:CCGGGCACCAATGTTCGAGAGTAATCTCGAGATTACTCTCGAACATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-239s1c1
Sequence:CCGGCACCAATGTTCGAGAGTAATTCTCGAGAATTACTCTCGAACATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-1902s1c1
Sequence:CCGGCGTCTTTGAAACCAAATCCATCTCGAGATGGATTTGGTTTCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130899
FAM71B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1850s21c1
Sequence:CCGGGAGATGATCAGTGGCACTATGCTCGAGCATAGTGCCACTGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1662s21c1
Sequence:CCGGCATCTAGCACAGGAGCTTTACCTCGAGGTAAAGCTCCTGTGCTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130899.2-1105s21c1
Sequence:CCGGCATATCCTCAGAGGGTATTAGCTCGAGCTAATACCCTCTGAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-1892s1c1
Sequence:CCGGCGGAGATGATCGTCTTTGAAACTCGAGTTTCAAAGACGATCATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-467s1c1
Sequence:CCGGCGAGACTGCTTCCCTTGAAATCTCGAGATTTCAAGGGAAGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-986s1c1
Sequence:CCGGCAGGTGCTATGAGCATAGCAACTCGAGTTGCTATGCTCATAGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-1630s1c1
Sequence:CCGGGAGTCGAGAACAACTCAGGAACTCGAGTTCCTGAGTTGTTCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-926s1c1
Sequence:CCGGGAACAGCAACAGGACCTAGAACTCGAGTTCTAGGTCCTGTTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130899.1-238s1c1
Sequence:CCGGGCACCAATGTTCGAGAGTAATCTCGAGATTACTCTCGAACATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-239s1c1
Sequence:CCGGCACCAATGTTCGAGAGTAATTCTCGAGAATTACTCTCGAACATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130899.1-1902s1c1
Sequence:CCGGCGTCTTTGAAACCAAATCCATCTCGAGATGGATTTGGTTTCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013783
FAM71B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1466s1c1
Sequence:CCGGCCTGCTGAAGATAAACCTGAACTCGAGTTCAGGTTTATCTTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1306s1c1
Sequence:CCGGCATGGCACTTGCTGCAAACATCTCGAGATGTTTGCAGCAAGTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1542s1c1
Sequence:CCGGGCCAGAAGGTTTCCCAAACTACTCGAGTAGTTTGGGAAACCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-627s1c1
Sequence:CCGGCAATGACCAATTGCATCAGTACTCGAGTACTGATGCAATTGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013783
FAM71B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1466s1c1
Sequence:CCGGCCTGCTGAAGATAAACCTGAACTCGAGTTCAGGTTTATCTTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1306s1c1
Sequence:CCGGCATGGCACTTGCTGCAAACATCTCGAGATGTTTGCAGCAAGTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1542s1c1
Sequence:CCGGGCCAGAAGGTTTCCCAAACTACTCGAGTAGTTTGGGAAACCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-627s1c1
Sequence:CCGGCAATGACCAATTGCATCAGTACTCGAGTACTGATGCAATTGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013783
FAM71B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1466s1c1
Sequence:CCGGCCTGCTGAAGATAAACCTGAACTCGAGTTCAGGTTTATCTTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1306s1c1
Sequence:CCGGCATGGCACTTGCTGCAAACATCTCGAGATGTTTGCAGCAAGTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-1542s1c1
Sequence:CCGGGCCAGAAGGTTTCCCAAACTACTCGAGTAGTTTGGGAAACCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013783.1-627s1c1
Sequence:CCGGCAATGACCAATTGCATCAGTACTCGAGTACTGATGCAATTGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks