EMAIL THIS PAGE TO A FRIEND

FAM71C

family with sequence similarity 71, member C

50 Gene Product Result for
UniProtKB ID: Q8NEG0
Gene ID:
cow(101903934) family with sequence similarity 71, member C
domestic cat(101094516) family with sequence similarity 71, member C
sheep(101120822) family with sequence similarity 71, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153364 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120281 MISSION® esiRNA esiRNA human FAM71C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153364 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107460 predicted 1118
2 SASI_Hs01_00107461 predicted 520
3 SASI_Hs02_00367232 predicted 516
4 SASI_Hs01_00107462 predicted 515
5 SASI_Hs01_00107463 predicted 1137
6 SASI_Hs01_00107464 predicted 1032
7 SASI_Hs01_00107465 predicted 1118
8 SASI_Hs02_00367233 predicted 1148
9 SASI_Hs01_00107466 predicted 543
10 SASI_Hs01_00107467 predicted 1061
11 SASI_Hs01_00107468 predicted 1081
12 SASI_Hs01_00107469 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153364
FAM71C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-567s1c1
Sequence:CCGGGACTTTATCCAGATCAGCAAACTCGAGTTTGCTGATCTGGATAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153364.1-1456s1c1
Sequence:CCGGCAAGCATATCAGTAAGTGCTACTCGAGTAGCACTTACTGATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-1087s1c1
Sequence:CCGGGACTTCACATGAATGCTGAAACTCGAGTTTCAGCATTCATGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153364.1-554s1c1
Sequence:CCGGCATGTTTGAGAGCGACTTTATCTCGAGATAAAGTCGCTCTCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153364.1-889s1c1
Sequence:CCGGCGGATGCAAGTGAAGACCTTTCTCGAGAAAGGTCTTCACTTGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-512s1c1
Sequence:CCGGGCAACTGTACAAAGGCGAGTACTCGAGTACTCGCCTTTGTACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-782s1c1
Sequence:CCGGGCTTCCCTTGATGTTTGTGAACTCGAGTTCACAAACATCAAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153364
FAM71C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-567s1c1
Sequence:CCGGGACTTTATCCAGATCAGCAAACTCGAGTTTGCTGATCTGGATAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153364.1-1456s1c1
Sequence:CCGGCAAGCATATCAGTAAGTGCTACTCGAGTAGCACTTACTGATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-1087s1c1
Sequence:CCGGGACTTCACATGAATGCTGAAACTCGAGTTTCAGCATTCATGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153364.1-554s1c1
Sequence:CCGGCATGTTTGAGAGCGACTTTATCTCGAGATAAAGTCGCTCTCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153364.1-889s1c1
Sequence:CCGGCGGATGCAAGTGAAGACCTTTCTCGAGAAAGGTCTTCACTTGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-512s1c1
Sequence:CCGGGCAACTGTACAAAGGCGAGTACTCGAGTACTCGCCTTTGTACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-782s1c1
Sequence:CCGGGCTTCCCTTGATGTTTGTGAACTCGAGTTCACAAACATCAAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153364
FAM71C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-567s1c1
Sequence:CCGGGACTTTATCCAGATCAGCAAACTCGAGTTTGCTGATCTGGATAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153364.1-1456s1c1
Sequence:CCGGCAAGCATATCAGTAAGTGCTACTCGAGTAGCACTTACTGATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-1087s1c1
Sequence:CCGGGACTTCACATGAATGCTGAAACTCGAGTTTCAGCATTCATGTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153364.1-554s1c1
Sequence:CCGGCATGTTTGAGAGCGACTTTATCTCGAGATAAAGTCGCTCTCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153364.1-889s1c1
Sequence:CCGGCGGATGCAAGTGAAGACCTTTCTCGAGAAAGGTCTTCACTTGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-512s1c1
Sequence:CCGGGCAACTGTACAAAGGCGAGTACTCGAGTACTCGCCTTTGTACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153364.1-782s1c1
Sequence:CCGGGCTTCCCTTGATGTTTGTGAACTCGAGTTCACAAACATCAAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks