EMAIL THIS PAGE TO A FRIEND

FAM71D

family with sequence similarity 71, member D

61 Gene Product Result for
Synonyms: C14orf54
UniProtKB ID: Q8N9W8, Q86VN4
Gene ID:
Mouse(70897) family with sequence similarity 71, member D
Rat(366671) family with sequence similarity 71, member D
sheep(101112903) family with sequence similarity 71, member D
naked mole-rat(101699618) family with sequence similarity 71, member D
domestic guinea pig(100735381) family with sequence similarity 71, member D
dog(480359) family with sequence similarity 71, member D
domestic cat(101090698) family with sequence similarity 71, member D
cow(618905) family with sequence similarity 71, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088461 MISSION® esiRNA esiRNA human FAM71D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173526 Rosetta Predictions human pricing
NM_001017469 Rosetta Predictions rat pricing
NM_027597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182822 predicted 1207
2 SASI_Hs01_00182823 predicted 1138
3 SASI_Hs01_00182824 predicted 937
4 SASI_Hs02_00368307 predicted 1342
5 SASI_Hs01_00182825 predicted 386
6 SASI_Hs02_00368308 predicted 1499
7 SASI_Hs01_00182827 predicted 793
8 SASI_Hs01_00182828 predicted 1220
9 SASI_Hs01_00182829 predicted 1448
10 SASI_Hs02_00368309 predicted 1023
11 SASI_Hs01_00182820 predicted 423
12 SASI_Hs01_00182821 predicted 1190
13 SASI_Hs01_00182826 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071759 predicted 574
2 SASI_Rn01_00071760 predicted 524
3 SASI_Rn01_00071761 predicted 1180
4 SASI_Rn01_00071762 predicted 603
5 SASI_Rn01_00071763 predicted 841
6 SASI_Rn01_00071764 predicted 563
7 SASI_Rn01_00071765 predicted 594
8 SASI_Rn01_00071766 predicted 271
9 SASI_Rn01_00071767 predicted 228
10 SASI_Rn02_00202275 predicted 534
11 SASI_Rn01_00071768 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124005 predicted 831
2 SASI_Mm01_00124006 predicted 1114
3 SASI_Mm01_00124007 predicted 1271
4 SASI_Mm01_00124008 predicted 396
5 SASI_Mm01_00124010 predicted 530
6 SASI_Mm01_00124011 predicted 1330
7 SASI_Mm01_00124012 predicted 1365
8 SASI_Mm01_00124013 predicted 220
9 SASI_Mm02_00332448 predicted 1261
10 SASI_Mm01_00124014 predicted 570
11 SASI_Mm01_00124009 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173526
FAM71D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member D
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-795s1c1
Sequence:CCGGGTTTCCAAAGTGTCGGAGGTTCTCGAGAACCTCCGACACTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-667s1c1
Sequence:CCGGGCCTGAAAGTAAAGCTGGTGACTCGAGTCACCAGCTTTACTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1150s1c1
Sequence:CCGGCCAAGCAAGAGGAGAAGGAAACTCGAGTTTCCTTCTCCTCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-1411s1c1
Sequence:CCGGCCAGGAGCTTGAGAACTGAATCTCGAGATTCAGTTCTCAAGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-654s1c1
Sequence:CCGGGCGGAGAACATGAGCCTGAAACTCGAGTTTCAGGCTCATGTTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-1467s1c1
Sequence:CCGGCCTTCTAATTTCCTCAAACTTCTCGAGAAGTTTGAGGAAATTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-942s1c1
Sequence:CCGGGACAGCATAGATTTCCCAGAACTCGAGTTCTGGGAAATCTATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1191s1c1
Sequence:CCGGCCTGGGTGTTTACAAGATACACTCGAGTGTATCTTGTAAACACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1047s1c1
Sequence:CCGGGAAGTCATAGAAGTCAGAGAACTCGAGTTCTCTGACTTCTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-820s1c1
Sequence:CCGGGTCTCTCAGGAATTACGAATACTCGAGTATTCGTAATTCCTGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1312s1c1
Sequence:CCGGCAGTAGAAAGTGAGGCAAATACTCGAGTATTTGCCTCACTTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1245s1c1
Sequence:CCGGCATGTCACCATCTCAAACATACTCGAGTATGTTTGAGATGGTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173526
FAM71D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member D
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-795s1c1
Sequence:CCGGGTTTCCAAAGTGTCGGAGGTTCTCGAGAACCTCCGACACTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-667s1c1
Sequence:CCGGGCCTGAAAGTAAAGCTGGTGACTCGAGTCACCAGCTTTACTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1150s1c1
Sequence:CCGGCCAAGCAAGAGGAGAAGGAAACTCGAGTTTCCTTCTCCTCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-1411s1c1
Sequence:CCGGCCAGGAGCTTGAGAACTGAATCTCGAGATTCAGTTCTCAAGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-654s1c1
Sequence:CCGGGCGGAGAACATGAGCCTGAAACTCGAGTTTCAGGCTCATGTTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-1467s1c1
Sequence:CCGGCCTTCTAATTTCCTCAAACTTCTCGAGAAGTTTGAGGAAATTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-942s1c1
Sequence:CCGGGACAGCATAGATTTCCCAGAACTCGAGTTCTGGGAAATCTATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1191s1c1
Sequence:CCGGCCTGGGTGTTTACAAGATACACTCGAGTGTATCTTGTAAACACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1047s1c1
Sequence:CCGGGAAGTCATAGAAGTCAGAGAACTCGAGTTCTCTGACTTCTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-820s1c1
Sequence:CCGGGTCTCTCAGGAATTACGAATACTCGAGTATTCGTAATTCCTGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1312s1c1
Sequence:CCGGCAGTAGAAAGTGAGGCAAATACTCGAGTATTTGCCTCACTTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1245s1c1
Sequence:CCGGCATGTCACCATCTCAAACATACTCGAGTATGTTTGAGATGGTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173526
FAM71D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member D
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-795s1c1
Sequence:CCGGGTTTCCAAAGTGTCGGAGGTTCTCGAGAACCTCCGACACTTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-667s1c1
Sequence:CCGGGCCTGAAAGTAAAGCTGGTGACTCGAGTCACCAGCTTTACTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1150s1c1
Sequence:CCGGCCAAGCAAGAGGAGAAGGAAACTCGAGTTTCCTTCTCCTCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-1411s1c1
Sequence:CCGGCCAGGAGCTTGAGAACTGAATCTCGAGATTCAGTTCTCAAGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-654s1c1
Sequence:CCGGGCGGAGAACATGAGCCTGAAACTCGAGTTTCAGGCTCATGTTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-1467s1c1
Sequence:CCGGCCTTCTAATTTCCTCAAACTTCTCGAGAAGTTTGAGGAAATTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173526.1-942s1c1
Sequence:CCGGGACAGCATAGATTTCCCAGAACTCGAGTTCTGGGAAATCTATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1191s1c1
Sequence:CCGGCCTGGGTGTTTACAAGATACACTCGAGTGTATCTTGTAAACACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1047s1c1
Sequence:CCGGGAAGTCATAGAAGTCAGAGAACTCGAGTTCTCTGACTTCTATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-820s1c1
Sequence:CCGGGTCTCTCAGGAATTACGAATACTCGAGTATTCGTAATTCCTGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1312s1c1
Sequence:CCGGCAGTAGAAAGTGAGGCAAATACTCGAGTATTTGCCTCACTTTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173526.1-1245s1c1
Sequence:CCGGCATGTCACCATCTCAAACATACTCGAGTATGTTTGAGATGGTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027597
FAM71D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member D
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-390s1c1
Sequence:CCGGCGTAGGCATCTGTTCTTCCAACTCGAGTTGGAAGAACAGATGCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027597.2-1369s1c1
Sequence:CCGGGCTTGGAAGATATTTGCACAACTCGAGTTGTGCAAATATCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-213s1c1
Sequence:CCGGGAATAAGCAAGAAGCCCTCTTCTCGAGAAGAGGGCTTCTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-395s1c1
Sequence:CCGGGCATCTGTTCTTCCAATCCCACTCGAGTGGGATTGGAAGAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.2-307s1c1
Sequence:CCGGCCTCCTATACTGGAGAGCAATCTCGAGATTGCTCTCCAGTATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027597.4-978s21c1
Sequence:CCGGACACACAGATACCCTTGTAACCTCGAGGTTACAAGGGTATCTGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027597.3-1399s1c1
Sequence:CCGGCTCTAGAGAACAATCCTTTATCTCGAGATAAAGGATTGTTCTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-1278s1c1
Sequence:CCGGCAAAGAAATATGTGATGAAACCTCGAGGTTTCATCACATATTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-945s1c1
Sequence:CCGGGATCACAGATGTTCAAGATATCTCGAGATATCTTGAACATCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-1187s1c1
Sequence:CCGGCTGTCACCATGTCAAACATAGCTCGAGCTATGTTTGACATGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027597.4-716s21c1
Sequence:CCGGTGCTAAGAACATGCGTCTCAACTCGAGTTGAGACGCATGTTCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027597
FAM71D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member D
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-390s1c1
Sequence:CCGGCGTAGGCATCTGTTCTTCCAACTCGAGTTGGAAGAACAGATGCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027597.2-1369s1c1
Sequence:CCGGGCTTGGAAGATATTTGCACAACTCGAGTTGTGCAAATATCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-213s1c1
Sequence:CCGGGAATAAGCAAGAAGCCCTCTTCTCGAGAAGAGGGCTTCTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-395s1c1
Sequence:CCGGGCATCTGTTCTTCCAATCCCACTCGAGTGGGATTGGAAGAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.2-307s1c1
Sequence:CCGGCCTCCTATACTGGAGAGCAATCTCGAGATTGCTCTCCAGTATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027597.4-978s21c1
Sequence:CCGGACACACAGATACCCTTGTAACCTCGAGGTTACAAGGGTATCTGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027597.3-1399s1c1
Sequence:CCGGCTCTAGAGAACAATCCTTTATCTCGAGATAAAGGATTGTTCTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-1278s1c1
Sequence:CCGGCAAAGAAATATGTGATGAAACCTCGAGGTTTCATCACATATTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-945s1c1
Sequence:CCGGGATCACAGATGTTCAAGATATCTCGAGATATCTTGAACATCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-1187s1c1
Sequence:CCGGCTGTCACCATGTCAAACATAGCTCGAGCTATGTTTGACATGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027597.4-716s21c1
Sequence:CCGGTGCTAAGAACATGCGTCTCAACTCGAGTTGAGACGCATGTTCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027597
FAM71D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member D
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-390s1c1
Sequence:CCGGCGTAGGCATCTGTTCTTCCAACTCGAGTTGGAAGAACAGATGCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027597.2-1369s1c1
Sequence:CCGGGCTTGGAAGATATTTGCACAACTCGAGTTGTGCAAATATCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-213s1c1
Sequence:CCGGGAATAAGCAAGAAGCCCTCTTCTCGAGAAGAGGGCTTCTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027597.2-395s1c1
Sequence:CCGGGCATCTGTTCTTCCAATCCCACTCGAGTGGGATTGGAAGAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.2-307s1c1
Sequence:CCGGCCTCCTATACTGGAGAGCAATCTCGAGATTGCTCTCCAGTATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027597.4-978s21c1
Sequence:CCGGACACACAGATACCCTTGTAACCTCGAGGTTACAAGGGTATCTGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027597.3-1399s1c1
Sequence:CCGGCTCTAGAGAACAATCCTTTATCTCGAGATAAAGGATTGTTCTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-1278s1c1
Sequence:CCGGCAAAGAAATATGTGATGAAACCTCGAGGTTTCATCACATATTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-945s1c1
Sequence:CCGGGATCACAGATGTTCAAGATATCTCGAGATATCTTGAACATCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027597.3-1187s1c1
Sequence:CCGGCTGTCACCATGTCAAACATAGCTCGAGCTATGTTTGACATGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027597.4-716s21c1
Sequence:CCGGTGCTAAGAACATGCGTCTCAACTCGAGTTGAGACGCATGTTCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks