EMAIL THIS PAGE TO A FRIEND

FAM71E1

family with sequence similarity 71, member E1

138 Gene Product Result for
UniProtKB ID: Q6IPT2, Q96EJ5, Q9BSM9
Gene ID:
Mouse(75538) family with sequence similarity 71, member E1
Rat(361564) family with sequence similarity 71, member E1
dog(476403) family with sequence similarity 71, member E1
cow(617892) family with sequence similarity 71, member E1
domestic cat(101092411) family with sequence similarity 71, member E1
domestic guinea pig(100719580) family with sequence similarity 71, member E1
naked mole-rat(101698208) family with sequence similarity 71, member E1
sheep(101117271) family with sequence similarity 71, member E1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138411 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138411 Rosetta Predictions human pricing
XM_001077811 Rosetta Predictions rat pricing
XM_341847 Rosetta Predictions rat pricing
XM_133423 Rosetta Predictions mouse pricing
XM_901462 Rosetta Predictions mouse pricing
XM_901465 Rosetta Predictions mouse pricing
XM_901471 Rosetta Predictions mouse pricing
XM_901475 Rosetta Predictions mouse pricing
XM_901477 Rosetta Predictions mouse pricing
XM_901479 Rosetta Predictions mouse pricing
XM_901481 Rosetta Predictions mouse pricing
XM_924733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050860 predicted 424
2 SASI_Hs01_00050861 predicted 892
3 SASI_Hs01_00050862 predicted 865
4 SASI_Hs01_00050864 predicted 726
5 SASI_Hs01_00050865 predicted 889
6 SASI_Hs02_00363552 predicted 488
7 SASI_Hs01_00050866 predicted 870
8 SASI_Hs01_00050867 predicted 812
9 SASI_Hs01_00050868 predicted 458
10 SASI_Hs01_00050869 predicted 711
11 SASI_Hs01_00050863 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358612 predicted 354
2 SASI_Rn02_00358613 predicted 486
3 SASI_Rn02_00358614 predicted 629
4 SASI_Rn02_00358615 predicted 524
5 SASI_Rn02_00358616 predicted 470
6 SASI_Rn02_00358617 predicted 400
7 SASI_Rn02_00358618 predicted 542
8 SASI_Rn02_00358619 predicted 399
9 SASI_Rn02_00358620 predicted 529
10 SASI_Rn02_00358621 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393473 predicted 358
2 SASI_Rn02_00393474 predicted 483
3 SASI_Rn02_00393475 predicted 631
4 SASI_Rn02_00393476 predicted 528
5 SASI_Rn02_00393477 predicted 475
6 SASI_Rn02_00393478 predicted 399
7 SASI_Rn02_00393479 predicted 540
8 SASI_Rn02_00393480 predicted 398
9 SASI_Rn02_00393481 predicted 535
10 SASI_Rn02_00393482 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223072 predicted 863
2 SASI_Mm01_00223073 predicted 981
3 SASI_Mm01_00223074 predicted 854
4 SASI_Mm01_00223075 predicted 979
5 SASI_Mm01_00223076 predicted 926
6 SASI_Mm01_00223077 predicted 865
7 SASI_Mm01_00223078 predicted 1005
8 SASI_Mm01_00223079 predicted 305
9 SASI_Mm01_00223080 predicted 218
10 SASI_Mm01_00223081 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267420 predicted 266
2 SASI_Mm01_00267421 predicted 412
3 SASI_Mm01_00267422 predicted 270
4 SASI_Mm01_00267423 predicted 264
5 SASI_Mm01_00267424 predicted 377
6 SASI_Mm01_00267425 predicted 409
7 SASI_Mm01_00267426 predicted 415
8 SASI_Mm01_00267427 predicted 369
9 SASI_Mm01_00267428 predicted 380
10 SASI_Mm01_00267429 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279365 predicted 223
2 SASI_Mm01_00279366 predicted 216
3 SASI_Mm01_00279367 predicted 217
4 SASI_Mm01_00279368 predicted 214
5 SASI_Mm01_00279369 predicted 212
6 SASI_Mm01_00279370 predicted 205
7 SASI_Mm01_00279371 predicted 217
8 SASI_Mm01_00279372 predicted 395
9 SASI_Mm01_00279373 predicted 266
10 SASI_Mm01_00279374 predicted 189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228987 predicted 520
2 SASI_Mm01_00228988 predicted 530
3 SASI_Mm01_00228989 predicted 513
4 SASI_Mm01_00228990 predicted 471
5 SASI_Mm01_00228991 predicted 516
6 SASI_Mm01_00228992 predicted 510
7 SASI_Mm01_00228993 predicted 548
8 SASI_Mm01_00228994 predicted 544
9 SASI_Mm01_00228995 predicted 507
10 SASI_Mm01_00228996 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430166 predicted 289
2 SASI_Mm01_00248052 predicted 300
3 SASI_Mm01_00248053 predicted 206
4 SASI_Mm02_00430167 predicted 294
5 SASI_Mm02_00430168 predicted 328
6 SASI_Mm02_00430169 predicted 243
7 SASI_Mm01_00248055 predicted 213
8 SASI_Mm02_00430170 predicted 290
9 SASI_Mm02_00430171 predicted 197
10 SASI_Mm02_00430172 predicted 284
11 SASI_Mm01_00248046 predicted 211
12 SASI_Mm01_00248047 predicted 356
13 SASI_Mm01_00248048 predicted 211
14 SASI_Mm01_00248049 predicted 217
15 SASI_Mm01_00248050 predicted 325
16 SASI_Mm01_00248051 predicted 358
17 SASI_Mm01_00248054 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235976 predicted 516
2 SASI_Mm01_00235977 predicted 521
3 SASI_Mm01_00235978 predicted 514
4 SASI_Mm01_00235979 predicted 473
5 SASI_Mm01_00235980 predicted 514
6 SASI_Mm01_00235981 predicted 507
7 SASI_Mm01_00235982 predicted 553
8 SASI_Mm01_00235983 predicted 544
9 SASI_Mm01_00235984 predicted 512
10 SASI_Mm01_00235985 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266494 predicted 301
2 SASI_Mm01_00266495 predicted 315
3 SASI_Mm01_00266496 predicted 306
4 SASI_Mm01_00266497 predicted 258
5 SASI_Mm01_00266498 predicted 311
6 SASI_Mm01_00266499 predicted 295
7 SASI_Mm01_00266500 predicted 333
8 SASI_Mm01_00266501 predicted 338
9 SASI_Mm01_00266502 predicted 298
10 SASI_Mm01_00266503 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258042 predicted 372
2 SASI_Mm01_00258043 predicted 374
3 SASI_Mm01_00258044 predicted 367
4 SASI_Mm01_00258045 predicted 319
5 SASI_Mm01_00258046 predicted 366
6 SASI_Mm01_00258047 predicted 364
7 SASI_Mm01_00258048 predicted 397
8 SASI_Mm01_00258049 predicted 403
9 SASI_Mm01_00258050 predicted 361
10 SASI_Mm01_00258051 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444295 predicted 291
2 SASI_Mm02_00444296 predicted 304
3 SASI_Mm02_00444297 predicted 214
4 SASI_Mm02_00444298 predicted 297
5 SASI_Mm02_00444299 predicted 335
6 SASI_Mm02_00444300 predicted 250
7 SASI_Mm02_00444301 predicted 212
8 SASI_Mm02_00444302 predicted 295
9 SASI_Mm02_00444303 predicted 204
10 SASI_Mm02_00444304 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138411
FAM71E1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member E1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-861s21c1
Sequence:CCGGTGAAGTTCGTCCAGCTCTTTGCTCGAGCAAAGAGCTGGACGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-430s21c1
Sequence:CCGGGCTCTTGTGTGACGTCATAAACTCGAGTTTATGACGTCACACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-400s21c1
Sequence:CCGGTCCAGGGACGTCATCACAAATCTCGAGATTTGTGATGACGTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138411.1-1139s21c1
Sequence:CCGGCCGAATGACCAGAGATCAAAGCTCGAGCTTTGATCTCTGGTCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138411.1-1137s1c1
Sequence:CCGGCACCGAATGACCAGAGATCAACTCGAGTTGATCTCTGGTCATTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138411.1-1175s1c1
Sequence:CCGGCCGGGCAGATGAGATATTAAACTCGAGTTTAATATCTCATCTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138411.1-697s1c1
Sequence:CCGGCTTTGAGAGCAACTTCGTACACTCGAGTGTACGAAGTTGCTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138411
FAM71E1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member E1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-861s21c1
Sequence:CCGGTGAAGTTCGTCCAGCTCTTTGCTCGAGCAAAGAGCTGGACGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-430s21c1
Sequence:CCGGGCTCTTGTGTGACGTCATAAACTCGAGTTTATGACGTCACACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-400s21c1
Sequence:CCGGTCCAGGGACGTCATCACAAATCTCGAGATTTGTGATGACGTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138411.1-1139s21c1
Sequence:CCGGCCGAATGACCAGAGATCAAAGCTCGAGCTTTGATCTCTGGTCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138411.1-1137s1c1
Sequence:CCGGCACCGAATGACCAGAGATCAACTCGAGTTGATCTCTGGTCATTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138411.1-1175s1c1
Sequence:CCGGCCGGGCAGATGAGATATTAAACTCGAGTTTAATATCTCATCTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138411.1-697s1c1
Sequence:CCGGCTTTGAGAGCAACTTCGTACACTCGAGTGTACGAAGTTGCTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138411
FAM71E1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member E1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-861s21c1
Sequence:CCGGTGAAGTTCGTCCAGCTCTTTGCTCGAGCAAAGAGCTGGACGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-430s21c1
Sequence:CCGGGCTCTTGTGTGACGTCATAAACTCGAGTTTATGACGTCACACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138411.1-400s21c1
Sequence:CCGGTCCAGGGACGTCATCACAAATCTCGAGATTTGTGATGACGTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138411.1-1139s21c1
Sequence:CCGGCCGAATGACCAGAGATCAAAGCTCGAGCTTTGATCTCTGGTCATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138411.1-1137s1c1
Sequence:CCGGCACCGAATGACCAGAGATCAACTCGAGTTGATCTCTGGTCATTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138411.1-1175s1c1
Sequence:CCGGCCGGGCAGATGAGATATTAAACTCGAGTTTAATATCTCATCTGCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138411.1-697s1c1
Sequence:CCGGCTTTGAGAGCAACTTCGTACACTCGAGTGTACGAAGTTGCTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks