EMAIL THIS PAGE TO A FRIEND

FAM71E2

family with sequence similarity 71, member E2

105 Gene Product Result for
Synonyms: C19orf16
UniProtKB ID: Q8N5Q1
Gene ID:
Mouse(243822) family with sequence similarity 71, member E2
Rat(308344) family with sequence similarity 71, member E2
sheep(101120774) family with sequence similarity 71, member E2
naked mole-rat(101719823) family with sequence similarity 71, member E2
domestic guinea pig(100736096) family with sequence similarity 71, member E2
dog(476380) family with sequence similarity 71, member E2
cow(100336228) family with sequence similarity 71, member E2
domestic cat(101090815) family with sequence similarity 71, member E2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145402 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_371195 Rosetta Predictions human pricing
XR_040337 Rosetta Predictions human pricing
XR_040338 Rosetta Predictions human pricing
XR_040339 Rosetta Predictions human pricing
XM_001071633 Rosetta Predictions rat pricing
XM_218220 Rosetta Predictions rat pricing
NM_172895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263432 predicted 514
2 SASI_Hs01_00263433 predicted 1604
3 SASI_Hs01_00263434 predicted 291
4 SASI_Hs01_00263435 predicted 897
5 SASI_Hs01_00263436 predicted 1664
6 SASI_Hs01_00263437 predicted 293
7 SASI_Hs01_00263438 predicted 1030
8 SASI_Hs01_00263439 predicted 1941
9 SASI_Hs01_00263440 predicted 1662
10 SASI_Hs01_00263441 predicted 1672
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517942 predicted 1622
2 SASI_Hs02_00517943 predicted 311
3 SASI_Hs02_00517944 predicted 914
4 SASI_Hs02_00517945 predicted 1682
5 SASI_Hs02_00517946 predicted 1964
6 SASI_Hs02_00517947 predicted 1690
7 SASI_Hs02_00517948 predicted 1694
8 SASI_Hs02_00517949 predicted 1031
9 SASI_Hs02_00517950 predicted 326
10 SASI_Hs02_00517951 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517952 predicted 818
2 SASI_Hs02_00517953 predicted 1019
3 SASI_Hs02_00517954 predicted 644
4 SASI_Hs02_00517955 predicted 1084
5 SASI_Hs02_00517956 predicted 1342
6 SASI_Hs02_00517957 predicted 1095
7 SASI_Hs02_00517958 predicted 576
8 SASI_Hs02_00517959 predicted 214
9 SASI_Hs02_00517960 predicted 1502
10 SASI_Hs02_00517961 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517962 predicted 818
2 SASI_Hs02_00517963 predicted 1026
3 SASI_Hs02_00517964 predicted 649
4 SASI_Hs02_00517965 predicted 1563
5 SASI_Hs02_00517966 predicted 1093
6 SASI_Hs02_00517967 predicted 1348
7 SASI_Hs02_00517968 predicted 1102
8 SASI_Hs02_00517969 predicted 1628
9 SASI_Hs02_00517970 predicted 579
10 SASI_Hs02_00517971 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335808 predicted 1534
2 SASI_Rn02_00335809 predicted 1611
3 SASI_Rn02_00335810 predicted 1389
4 SASI_Rn02_00335811 predicted 307
5 SASI_Rn02_00335812 predicted 540
6 SASI_Rn02_00335813 predicted 1811
7 SASI_Rn02_00335814 predicted 1286
8 SASI_Rn02_00335815 predicted 878
9 SASI_Rn02_00335816 predicted 902
10 SASI_Rn02_00335817 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377563 predicted 480
2 SASI_Rn02_00377564 predicted 965
3 SASI_Rn02_00377565 predicted 497
4 SASI_Rn02_00377566 predicted 303
5 SASI_Rn02_00377567 predicted 876
6 SASI_Rn02_00377568 predicted 893
7 SASI_Rn02_00377569 predicted 288
8 SASI_Rn02_00377570 predicted 950
9 SASI_Rn02_00377571 predicted 870
10 SASI_Rn02_00377572 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125117 predicted 1996
2 SASI_Mm01_00125118 predicted 2367
3 SASI_Mm01_00125119 predicted 1025
4 SASI_Mm01_00125120 predicted 1175
5 SASI_Mm01_00125121 predicted 1085
6 SASI_Mm01_00125122 predicted 696
7 SASI_Mm01_00125123 predicted 2321
8 SASI_Mm01_00125124 predicted 1881
9 SASI_Mm01_00125125 predicted 1807
10 SASI_Mm01_00125126 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172895
FAM71E2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member E2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-591s1c1
Sequence:CCGGGACTGAAACTGCGTCTGAGATCTCGAGATCTCAGACGCAGTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-1087s1c1
Sequence:CCGGCATCATCTCTAACACGATAAACTCGAGTTTATCGTGTTAGAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172895.1-2471s1c1
Sequence:CCGGCCCAAGGATTTAAGATAACATCTCGAGATGTTATCTTAAATCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-2140s1c1
Sequence:CCGGCGAGGAGATAGCTGTTGAGAACTCGAGTTCTCAACAGCTATCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-258s21c1
Sequence:CCGGGACCCTTCAGATGGCCGAATACTCGAGTATTCGGCCATCTGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-963s21c1
Sequence:CCGGTGATAGATCCGAACCTCTAATCTCGAGATTAGAGGTTCGGATCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-2300s21c1
Sequence:CCGGGATCACAAGTAGTAGTCATAGCTCGAGCTATGACTACTACTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172895
FAM71E2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member E2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-591s1c1
Sequence:CCGGGACTGAAACTGCGTCTGAGATCTCGAGATCTCAGACGCAGTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-1087s1c1
Sequence:CCGGCATCATCTCTAACACGATAAACTCGAGTTTATCGTGTTAGAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172895.1-2471s1c1
Sequence:CCGGCCCAAGGATTTAAGATAACATCTCGAGATGTTATCTTAAATCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-2140s1c1
Sequence:CCGGCGAGGAGATAGCTGTTGAGAACTCGAGTTCTCAACAGCTATCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-258s21c1
Sequence:CCGGGACCCTTCAGATGGCCGAATACTCGAGTATTCGGCCATCTGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-963s21c1
Sequence:CCGGTGATAGATCCGAACCTCTAATCTCGAGATTAGAGGTTCGGATCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-2300s21c1
Sequence:CCGGGATCACAAGTAGTAGTCATAGCTCGAGCTATGACTACTACTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172895
FAM71E2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member E2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-591s1c1
Sequence:CCGGGACTGAAACTGCGTCTGAGATCTCGAGATCTCAGACGCAGTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-1087s1c1
Sequence:CCGGCATCATCTCTAACACGATAAACTCGAGTTTATCGTGTTAGAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172895.1-2471s1c1
Sequence:CCGGCCCAAGGATTTAAGATAACATCTCGAGATGTTATCTTAAATCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172895.1-2140s1c1
Sequence:CCGGCGAGGAGATAGCTGTTGAGAACTCGAGTTCTCAACAGCTATCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-258s21c1
Sequence:CCGGGACCCTTCAGATGGCCGAATACTCGAGTATTCGGCCATCTGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-963s21c1
Sequence:CCGGTGATAGATCCGAACCTCTAATCTCGAGATTAGAGGTTCGGATCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172895.3-2300s21c1
Sequence:CCGGGATCACAAGTAGTAGTCATAGCTCGAGCTATGACTACTACTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145402
FAM71E2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member E2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145402.1-2957s21c1
Sequence:CCGGCTCAGTTGGAAACTGTCCAGACTCGAGTCTGGACAGTTTCCAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-2820s21c1
Sequence:CCGGCATGCTCTTAGAACTTGAAACCTCGAGGTTTCAAGTTCTAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-2306s21c1
Sequence:CCGGCCAAAGAGCAGCCCTCGAAATCTCGAGATTTCGAGGGCTGCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-787s21c1
Sequence:CCGGGAGCGCAACTTTCCGCATAAGCTCGAGCTTATGCGGAAAGTTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-307s21c1
Sequence:CCGGCTGCCCATGTTCGAGAGTAACCTCGAGGTTACTCTCGAACATGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-1019s21c1
Sequence:CCGGGGACCATCTTCAGCATCATTTCTCGAGAAATGATGCTGAAGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-1399s21c1
Sequence:CCGGGGCCTTGTCACATCTTGTAAGCTCGAGCTTACAAGATGTGACAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145402
FAM71E2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member E2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145402.1-2957s21c1
Sequence:CCGGCTCAGTTGGAAACTGTCCAGACTCGAGTCTGGACAGTTTCCAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-2820s21c1
Sequence:CCGGCATGCTCTTAGAACTTGAAACCTCGAGGTTTCAAGTTCTAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-2306s21c1
Sequence:CCGGCCAAAGAGCAGCCCTCGAAATCTCGAGATTTCGAGGGCTGCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-787s21c1
Sequence:CCGGGAGCGCAACTTTCCGCATAAGCTCGAGCTTATGCGGAAAGTTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-307s21c1
Sequence:CCGGCTGCCCATGTTCGAGAGTAACCTCGAGGTTACTCTCGAACATGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-1019s21c1
Sequence:CCGGGGACCATCTTCAGCATCATTTCTCGAGAAATGATGCTGAAGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-1399s21c1
Sequence:CCGGGGCCTTGTCACATCTTGTAAGCTCGAGCTTACAAGATGTGACAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145402
FAM71E2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member E2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145402.1-2957s21c1
Sequence:CCGGCTCAGTTGGAAACTGTCCAGACTCGAGTCTGGACAGTTTCCAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-2820s21c1
Sequence:CCGGCATGCTCTTAGAACTTGAAACCTCGAGGTTTCAAGTTCTAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-2306s21c1
Sequence:CCGGCCAAAGAGCAGCCCTCGAAATCTCGAGATTTCGAGGGCTGCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-787s21c1
Sequence:CCGGGAGCGCAACTTTCCGCATAAGCTCGAGCTTATGCGGAAAGTTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-307s21c1
Sequence:CCGGCTGCCCATGTTCGAGAGTAACCTCGAGGTTACTCTCGAACATGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-1019s21c1
Sequence:CCGGGGACCATCTTCAGCATCATTTCTCGAGAAATGATGCTGAAGATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145402.1-1399s21c1
Sequence:CCGGGGCCTTGTCACATCTTGTAAGCTCGAGCTTACAAGATGTGACAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks