EMAIL THIS PAGE TO A FRIEND

FAM71F1

family with sequence similarity 71, member F1

136 Gene Product Result for
Synonyms: FAM137A NYD-SP18
UniProtKB ID: Q96KD3, Q8IY75
Gene ID:
Mouse(330277) family with sequence similarity 71, member F1
Rat(500061) family with sequence similarity 71, member F1
cow(539444) family with sequence similarity 71, member F1
domestic cat(101101298) family with sequence similarity 71, member F1
dog(475202) family with sequence similarity 71, member F1
domestic guinea pig(100717857) family with sequence similarity 71, member F1
naked mole-rat(101719421) family with sequence similarity 71, member F1
sheep(101111188) family with sequence similarity 71, member F1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065721 MISSION® esiRNA esiRNA human FAM71F1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032599 Rosetta Predictions human pricing
NM_001024324 Rosetta Predictions rat pricing
NM_207258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360138 predicted 558
2 SASI_Hs01_00076429 predicted 662
3 SASI_Hs01_00076430 predicted 906
4 SASI_Hs01_00076431 predicted 280
5 SASI_Hs02_00360139 predicted 853
6 SASI_Hs01_00076432 predicted 728
7 SASI_Hs01_00076433 predicted 314
8 SASI_Hs01_00076434 predicted 499
9 SASI_Hs01_00076435 predicted 669
10 SASI_Hs01_00076436 predicted 782
11 SASI_Hs01_00076437 predicted 890
12 SASI_Hs01_00076438 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116037 predicted 892
2 SASI_Rn01_00116038 predicted 458
3 SASI_Rn01_00116039 predicted 251
4 SASI_Rn01_00116040 predicted 840
5 SASI_Rn01_00116041 predicted 391
6 SASI_Rn01_00116042 predicted 1053
7 SASI_Rn01_00116043 predicted 221
8 SASI_Rn01_00116044 predicted 1060
9 SASI_Rn01_00116045 predicted 657
10 SASI_Rn01_00116046 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083995 predicted 471
2 SASI_Mm01_00083996 predicted 900
3 SASI_Mm01_00083997 predicted 1060
4 SASI_Mm02_00351998 predicted 1121
5 SASI_Mm01_00084000 predicted 732
6 SASI_Mm01_00084001 predicted 235
7 SASI_Mm01_00084002 predicted 1069
8 SASI_Mm01_00084003 predicted 270
9 SASI_Mm01_00084004 predicted 958
10 SASI_Mm02_00351999 predicted 400
11 SASI_Mm01_00083998 predicted 495
12 SASI_Mm01_00083999 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032599
FAM71F1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member F1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032599.2-1531s21c1
Sequence:CCGGGATGCTCACCAAGCTTCTATTCTCGAGAATAGAAGCTTGGTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-885s1c1
Sequence:CCGGGAGACCAACAAGAACAGCTCACTCGAGTGAGCTGTTCTTGTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032599.1-1355s1c1
Sequence:CCGGGAAAGGAGTGAAAGGGAAGTACTCGAGTACTTCCCTTTCACTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135359    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032599.1-1445s1c1
Sequence:CCGGGAGACACAAAGAGAAGTGGTACTCGAGTACCACTTCTCTTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-776s1c1
Sequence:CCGGCGAGAGTCTCATTCAGCTAATCTCGAGATTAGCTGAATGAGACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-628s1c1
Sequence:CCGGGACTGGTTCAAATTCTGCAAACTCGAGTTTGCAGAATTTGAACCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-113s1c1
Sequence:CCGGCACAAGATCCTATCCAACCTTCTCGAGAAGGTTGGATAGGATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032599.1-1346s1c1
Sequence:CCGGGAGATGAAGGAAAGGAGTGAACTCGAGTTCACTCCTTTCCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032599.1-263s1c1
Sequence:CCGGGTTTCTTGACTCCGTGGTGTTCTCGAGAACACCACGGAGTCAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032599
FAM71F1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member F1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032599.2-1531s21c1
Sequence:CCGGGATGCTCACCAAGCTTCTATTCTCGAGAATAGAAGCTTGGTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-885s1c1
Sequence:CCGGGAGACCAACAAGAACAGCTCACTCGAGTGAGCTGTTCTTGTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032599.1-1355s1c1
Sequence:CCGGGAAAGGAGTGAAAGGGAAGTACTCGAGTACTTCCCTTTCACTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135359    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032599.1-1445s1c1
Sequence:CCGGGAGACACAAAGAGAAGTGGTACTCGAGTACCACTTCTCTTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-776s1c1
Sequence:CCGGCGAGAGTCTCATTCAGCTAATCTCGAGATTAGCTGAATGAGACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-628s1c1
Sequence:CCGGGACTGGTTCAAATTCTGCAAACTCGAGTTTGCAGAATTTGAACCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-113s1c1
Sequence:CCGGCACAAGATCCTATCCAACCTTCTCGAGAAGGTTGGATAGGATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032599.1-1346s1c1
Sequence:CCGGGAGATGAAGGAAAGGAGTGAACTCGAGTTCACTCCTTTCCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032599.1-263s1c1
Sequence:CCGGGTTTCTTGACTCCGTGGTGTTCTCGAGAACACCACGGAGTCAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032599
FAM71F1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member F1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032599.2-1531s21c1
Sequence:CCGGGATGCTCACCAAGCTTCTATTCTCGAGAATAGAAGCTTGGTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-885s1c1
Sequence:CCGGGAGACCAACAAGAACAGCTCACTCGAGTGAGCTGTTCTTGTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032599.1-1355s1c1
Sequence:CCGGGAAAGGAGTGAAAGGGAAGTACTCGAGTACTTCCCTTTCACTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135359    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032599.1-1445s1c1
Sequence:CCGGGAGACACAAAGAGAAGTGGTACTCGAGTACCACTTCTCTTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-776s1c1
Sequence:CCGGCGAGAGTCTCATTCAGCTAATCTCGAGATTAGCTGAATGAGACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-628s1c1
Sequence:CCGGGACTGGTTCAAATTCTGCAAACTCGAGTTTGCAGAATTTGAACCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032599.1-113s1c1
Sequence:CCGGCACAAGATCCTATCCAACCTTCTCGAGAAGGTTGGATAGGATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032599.1-1346s1c1
Sequence:CCGGGAGATGAAGGAAAGGAGTGAACTCGAGTTCACTCCTTTCCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032599.1-263s1c1
Sequence:CCGGGTTTCTTGACTCCGTGGTGTTCTCGAGAACACCACGGAGTCAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207258
FAM71F1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member F1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-296s1c1
Sequence:CCGGGCAACTTTGTTCAGGTCAGAACTCGAGTTCTGACCTGAACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-264s1c1
Sequence:CCGGCAATCTGTTTCCTAACTCCGTCTCGAGACGGAGTTAGGAAACAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-312s1c1
Sequence:CCGGCAGAAGGAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-282s1c1
Sequence:CCGGCGTGGTGTTCGAAAGCAACTTCTCGAGAAGTTGCTTTCGAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-120s1c1
Sequence:CCGGGATAAGATCATATCCAACCTTCTCGAGAAGGTTGGATATGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207258
FAM71F1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member F1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-296s1c1
Sequence:CCGGGCAACTTTGTTCAGGTCAGAACTCGAGTTCTGACCTGAACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-264s1c1
Sequence:CCGGCAATCTGTTTCCTAACTCCGTCTCGAGACGGAGTTAGGAAACAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-312s1c1
Sequence:CCGGCAGAAGGAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-282s1c1
Sequence:CCGGCGTGGTGTTCGAAAGCAACTTCTCGAGAAGTTGCTTTCGAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-120s1c1
Sequence:CCGGGATAAGATCATATCCAACCTTCTCGAGAAGGTTGGATATGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207258
FAM71F1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member F1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-296s1c1
Sequence:CCGGGCAACTTTGTTCAGGTCAGAACTCGAGTTCTGACCTGAACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-264s1c1
Sequence:CCGGCAATCTGTTTCCTAACTCCGTCTCGAGACGGAGTTAGGAAACAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-312s1c1
Sequence:CCGGCAGAAGGAGCAGAAACTGGAACTCGAGTTCCAGTTTCTGCTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-282s1c1
Sequence:CCGGCGTGGTGTTCGAAAGCAACTTCTCGAGAAGTTGCTTTCGAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207258.1-120s1c1
Sequence:CCGGGATAAGATCATATCCAACCTTCTCGAGAAGGTTGGATATGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks