EMAIL THIS PAGE TO A FRIEND

FAM71F2

family with sequence similarity 71, member F2

Synonyms: FAM137B
UniProtKB ID: Q6NXP2, Q0VGF6, Q0VGF7, Q86X39
Gene ID:
Mouse(245884) family with sequence similarity 71, member F2
Rat(500060) family with sequence similarity 71, member F2
sheep(101110934) family with sequence similarity 71, member F2
naked mole-rat(101719776) family with sequence similarity 71, member F2
domestic guinea pig(100728729) family with sequence similarity 71, member F2
domestic cat(101100877) family with sequence similarity 71, member F2
cow(540061) family with sequence similarity 71, member F2
dog(608767) family with sequence similarity 71, member F2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102681 MISSION® esiRNA esiRNA human FAM71F2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012454 Rosetta Predictions human pricing
NM_001024323 Rosetta Predictions rat pricing
NM_001101486 Rosetta Predictions mouse pricing
XM_994878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306150 predicted 893
2 SASI_Hs01_00103931 predicted 529
3 SASI_Hs01_00103932 predicted 649
4 SASI_Hs01_00103933 predicted 552
5 SASI_Hs01_00103934 predicted 892
6 SASI_Hs01_00103935 predicted 574
7 SASI_Hs01_00103937 predicted 647
8 SASI_Hs01_00103939 predicted 279
9 SASI_Hs02_00306151 predicted 817
10 SASI_Hs01_00103940 predicted 897
11 SASI_Hs01_00103936 predicted 979
12 SASI_Hs01_00103938 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095430 predicted 220
2 SASI_Rn01_00095431 predicted 245
3 SASI_Rn01_00095432 predicted 210
4 SASI_Rn01_00095433 predicted 470
5 SASI_Rn01_00095434 predicted 747
6 SASI_Rn01_00095435 predicted 431
7 SASI_Rn01_00095436 predicted 596
8 SASI_Rn01_00095437 predicted 893
9 SASI_Rn02_00202538 predicted 268
10 SASI_Rn02_00202539 predicted 654
11 SASI_Rn01_00095428 predicted 288
12 SASI_Rn01_00095429 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302487 predicted 289
2 SASI_Mm02_00302488 predicted 558
3 SASI_Mm02_00302489 predicted 250
4 SASI_Mm02_00302490 predicted 257
5 SASI_Mm02_00302491 predicted 938
6 SASI_Mm02_00302492 predicted 312
7 SASI_Mm02_00302493 predicted 198
8 SASI_Mm02_00302494 predicted 800
9 SASI_Mm02_00302495 predicted 203
10 SASI_Mm02_00302496 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222495 predicted 344
2 SASI_Mm01_00222496 predicted 372
3 SASI_Mm01_00222497 predicted 324
4 SASI_Mm01_00222498 predicted 363
5 SASI_Mm01_00222499 predicted 285
6 SASI_Mm01_00222500 predicted 348
7 SASI_Mm01_00222501 predicted 320
8 SASI_Mm01_00222502 predicted 285
9 SASI_Mm01_00222503 predicted 206
10 SASI_Mm01_00222504 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012454
FAM71F2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member F2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-900s1c1
Sequence:CCGGCCAGTGGCATCTCCAATCAATCTCGAGATTGATTGGAGATGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-831s1c1
Sequence:CCGGCTCACAGCAGACAGGAACAATCTCGAGATTGTTCCTGTCTGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-712s1c1
Sequence:CCGGCCACAGAAACAACACCTGAAACTCGAGTTTCAGGTGTTGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-906s1c1
Sequence:CCGGGCATCTCCAATCAATTTGAATCTCGAGATTCAAATTGATTGGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-983s1c1
Sequence:CCGGGCACCTTCTACAAGTTCATATCTCGAGATATGAACTTGTAGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012454.3-1119s21c1
Sequence:CCGGTGACCTTGGGAGAGGTAAGATCTCGAGATCTTACCTCTCCCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012454.3-385s21c1
Sequence:CCGGCCTCCTGATGGCCAATGTTACCTCGAGGTAACATTGGCCATCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012454
FAM71F2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member F2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-900s1c1
Sequence:CCGGCCAGTGGCATCTCCAATCAATCTCGAGATTGATTGGAGATGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-831s1c1
Sequence:CCGGCTCACAGCAGACAGGAACAATCTCGAGATTGTTCCTGTCTGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-712s1c1
Sequence:CCGGCCACAGAAACAACACCTGAAACTCGAGTTTCAGGTGTTGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-906s1c1
Sequence:CCGGGCATCTCCAATCAATTTGAATCTCGAGATTCAAATTGATTGGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-983s1c1
Sequence:CCGGGCACCTTCTACAAGTTCATATCTCGAGATATGAACTTGTAGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012454.3-1119s21c1
Sequence:CCGGTGACCTTGGGAGAGGTAAGATCTCGAGATCTTACCTCTCCCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012454.3-385s21c1
Sequence:CCGGCCTCCTGATGGCCAATGTTACCTCGAGGTAACATTGGCCATCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012454
FAM71F2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member F2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-900s1c1
Sequence:CCGGCCAGTGGCATCTCCAATCAATCTCGAGATTGATTGGAGATGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-831s1c1
Sequence:CCGGCTCACAGCAGACAGGAACAATCTCGAGATTGTTCCTGTCTGCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-712s1c1
Sequence:CCGGCCACAGAAACAACACCTGAAACTCGAGTTTCAGGTGTTGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-906s1c1
Sequence:CCGGGCATCTCCAATCAATTTGAATCTCGAGATTCAAATTGATTGGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012454.1-983s1c1
Sequence:CCGGGCACCTTCTACAAGTTCATATCTCGAGATATGAACTTGTAGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012454.3-1119s21c1
Sequence:CCGGTGACCTTGGGAGAGGTAAGATCTCGAGATCTTACCTCTCCCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012454.3-385s21c1
Sequence:CCGGCCTCCTGATGGCCAATGTTACCTCGAGGTAACATTGGCCATCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101486
FAM71F2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 71, member F2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-295s21c1
Sequence:CCGGCTGGATGGATGCCTATGAAAGCTCGAGCTTTCATAGGCATCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-1000s21c1
Sequence:CCGGGAACTTGTTGGGACCCTAATACTCGAGTATTAGGGTCCCAACAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101486.1-1020s21c1
Sequence:CCGGACCTAGCCAGAGTCGGGTGTTCTCGAGAACACCCGACTCTGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-202s21c1
Sequence:CCGGGCTTTGTCAACTGATTCATTCCTCGAGGAATGAATCAGTTGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101486
FAM71F2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 71, member F2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-295s21c1
Sequence:CCGGCTGGATGGATGCCTATGAAAGCTCGAGCTTTCATAGGCATCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-1000s21c1
Sequence:CCGGGAACTTGTTGGGACCCTAATACTCGAGTATTAGGGTCCCAACAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101486.1-1020s21c1
Sequence:CCGGACCTAGCCAGAGTCGGGTGTTCTCGAGAACACCCGACTCTGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-202s21c1
Sequence:CCGGGCTTTGTCAACTGATTCATTCCTCGAGGAATGAATCAGTTGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101486
FAM71F2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 71, member F2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-295s21c1
Sequence:CCGGCTGGATGGATGCCTATGAAAGCTCGAGCTTTCATAGGCATCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-1000s21c1
Sequence:CCGGGAACTTGTTGGGACCCTAATACTCGAGTATTAGGGTCCCAACAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101486.1-1020s21c1
Sequence:CCGGACCTAGCCAGAGTCGGGTGTTCTCGAGAACACCCGACTCTGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101486.1-202s21c1
Sequence:CCGGGCTTTGTCAACTGATTCATTCCTCGAGGAATGAATCAGTTGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks