EMAIL THIS PAGE TO A FRIEND

FAM72A

family with sequence similarity 72, member A

Synonyms: LMPIP
UniProtKB ID: Q5TYM5, B2RV15, Q5TYM4
Gene ID:
Mouse(108900) family with sequence similarity 72, member A
Rat(681249) family with sequence similarity 72, member A
chicken(419841) family with sequence similarity 72, member A
cow(616965) family with sequence similarity 72, member A
domestic cat(101088974) family with sequence similarity 72, member A
dog(607371) family with sequence similarity 72, member A
domestic guinea pig(100717211) family with sequence similarity 72, member A
naked mole-rat(101698321) family with sequence similarity 72, member A
sheep(101116244) family with sequence similarity 72, member A
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043271 Anti-FAM72A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123168 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123168 Rosetta Predictions human pricing
NM_001081451 Rosetta Predictions rat pricing
NM_175382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327725 predicted 617
2 SASI_Hs02_00327726 predicted 642
3 SASI_Hs02_00327727 predicted 562
4 SASI_Hs02_00327728 predicted 682
5 SASI_Hs02_00327729 predicted 711
6 SASI_Hs02_00327730 predicted 768
7 SASI_Hs02_00327731 predicted 552
8 SASI_Hs02_00327732 predicted 638
9 SASI_Hs02_00327733 predicted 762
10 SASI_Hs02_00327734 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208609 predicted 222
2 SASI_Rn02_00208610 predicted 202
3 SASI_Rn02_00208611 predicted 199
4 SASI_Rn02_00208612 predicted 199
5 SASI_Rn02_00208613 predicted 205
6 SASI_Rn02_00208614 predicted 193
7 SASI_Rn02_00208615 predicted 200
8 SASI_Rn02_00208616 predicted 98
9 SASI_Rn02_00208617 predicted 167
10 SASI_Rn02_00208618 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108813 predicted 1095
2 SASI_Mm01_00108814 predicted 1243
3 SASI_Mm01_00108815 predicted 817
4 SASI_Mm01_00108816 predicted 1049
5 SASI_Mm01_00108817 predicted 981
6 SASI_Mm01_00108818 predicted 965
7 SASI_Mm02_00346211 predicted 1084
8 SASI_Mm01_00108819 predicted 1005
9 SASI_Mm01_00108820 predicted 928
10 SASI_Mm01_00108821 predicted 756
11 SASI_Mm01_00108812 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123168
VALIDATED
FAM72A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 72, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-826s21c1
Sequence:CCGGAGAGGAGTGTATTAGATAAATCTCGAGATTTATCTAATACACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-748s21c1
Sequence:CCGGAGGTGTAAACGTCCTACTTTGCTCGAGCAAAGTAGGACGTTTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-624s21c1
Sequence:CCGGGTGGGAACATTGTAGGTTATCCTCGAGGATAACCTACAATGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123168.1-1162s21c1
Sequence:CCGGTTGATACCAGATACCATTAATCTCGAGATTAATGGTATCTGGTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-712s21c1
Sequence:CCGGCCAGGCAGTTTATGATATTAACTCGAGTTAATATCATAAACTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123168
VALIDATED
FAM72A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 72, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-826s21c1
Sequence:CCGGAGAGGAGTGTATTAGATAAATCTCGAGATTTATCTAATACACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-748s21c1
Sequence:CCGGAGGTGTAAACGTCCTACTTTGCTCGAGCAAAGTAGGACGTTTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-624s21c1
Sequence:CCGGGTGGGAACATTGTAGGTTATCCTCGAGGATAACCTACAATGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123168.1-1162s21c1
Sequence:CCGGTTGATACCAGATACCATTAATCTCGAGATTAATGGTATCTGGTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-712s21c1
Sequence:CCGGCCAGGCAGTTTATGATATTAACTCGAGTTAATATCATAAACTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123168
VALIDATED
FAM72A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 72, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-826s21c1
Sequence:CCGGAGAGGAGTGTATTAGATAAATCTCGAGATTTATCTAATACACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-748s21c1
Sequence:CCGGAGGTGTAAACGTCCTACTTTGCTCGAGCAAAGTAGGACGTTTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-624s21c1
Sequence:CCGGGTGGGAACATTGTAGGTTATCCTCGAGGATAACCTACAATGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123168.1-1162s21c1
Sequence:CCGGTTGATACCAGATACCATTAATCTCGAGATTAATGGTATCTGGTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001123168.1-712s21c1
Sequence:CCGGCCAGGCAGTTTATGATATTAACTCGAGTTAATATCATAAACTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175382
VALIDATED
FAM72A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 72, member A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175382.2-1120s1c1
Sequence:CCGGGATGAAGAAACGCTAGAGATTCTCGAGAATCTCTAGCGTTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175382.2-816s1c1
Sequence:CCGGGCTGGCTGATACTGACATAGACTCGAGTCTATGTCAGTATCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175382.2-959s1c1
Sequence:CCGGGCTACCACGTAATTGTTCCATCTCGAGATGGAACAATTACGTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175382.2-759s1c1
Sequence:CCGGCCTGTGTTGCAAATTCTGTAACTCGAGTTACAGAATTTGCAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175382.2-1294s1c1
Sequence:CCGGGCGATTTCAAATCAATGACTTCTCGAGAAGTCATTGATTTGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175382.2-869s1c1
Sequence:CCGGCAGTGGATTTCATTGGAAGATCTCGAGATCTTCCAATGAAATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175382
VALIDATED
FAM72A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 72, member A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175382.2-1120s1c1
Sequence:CCGGGATGAAGAAACGCTAGAGATTCTCGAGAATCTCTAGCGTTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175382.2-816s1c1
Sequence:CCGGGCTGGCTGATACTGACATAGACTCGAGTCTATGTCAGTATCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175382.2-959s1c1
Sequence:CCGGGCTACCACGTAATTGTTCCATCTCGAGATGGAACAATTACGTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175382.2-759s1c1
Sequence:CCGGCCTGTGTTGCAAATTCTGTAACTCGAGTTACAGAATTTGCAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175382.2-1294s1c1
Sequence:CCGGGCGATTTCAAATCAATGACTTCTCGAGAAGTCATTGATTTGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175382.2-869s1c1
Sequence:CCGGCAGTGGATTTCATTGGAAGATCTCGAGATCTTCCAATGAAATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175382
VALIDATED
FAM72A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 72, member A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175382.2-1120s1c1
Sequence:CCGGGATGAAGAAACGCTAGAGATTCTCGAGAATCTCTAGCGTTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175382.2-816s1c1
Sequence:CCGGGCTGGCTGATACTGACATAGACTCGAGTCTATGTCAGTATCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175382.2-959s1c1
Sequence:CCGGGCTACCACGTAATTGTTCCATCTCGAGATGGAACAATTACGTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175382.2-759s1c1
Sequence:CCGGCCTGTGTTGCAAATTCTGTAACTCGAGTTACAGAATTTGCAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175382.2-1294s1c1
Sequence:CCGGGCGATTTCAAATCAATGACTTCTCGAGAAGTCATTGATTTGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175382.2-869s1c1
Sequence:CCGGCAGTGGATTTCATTGGAAGATCTCGAGATCTTCCAATGAAATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks