EMAIL THIS PAGE TO A FRIEND

FAM72B

family with sequence similarity 72, member B

53 Gene Product Result for
Synonyms: p17
Species: Human FAM72B(653820)
UniProtKB ID: Q86X60, B2RPQ5, Q5QP15
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100910 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146991 MISSION® esiRNA esiRNA human FAM72B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100910 Rosetta Predictions human pricing
XM_930579 Rosetta Predictions human pricing
XM_935475 Rosetta Predictions human pricing
XM_935476 Rosetta Predictions human pricing
XM_935477 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322495 predicted 1280
2 SASI_Hs02_00322496 predicted 1060
3 SASI_Hs02_00322497 predicted 995
4 SASI_Hs02_00322498 predicted 1076
5 SASI_Hs02_00322499 predicted 1124
6 SASI_Hs02_00322500 predicted 1181
7 SASI_Hs02_00322501 predicted 1119
8 SASI_Hs02_00322502 predicted 1143
9 SASI_Hs02_00322503 predicted 1429
10 SASI_Hs02_00322504 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283158 predicted 1543
2 SASI_Hs01_00283159 predicted 1319
3 SASI_Hs01_00283160 predicted 1226
4 SASI_Hs01_00283161 predicted 1300
5 SASI_Hs01_00283162 predicted 1223
6 SASI_Hs01_00283163 predicted 1574
7 SASI_Hs01_00283164 predicted 1579
8 SASI_Hs01_00283165 predicted 1245
9 SASI_Hs01_00283166 predicted 1246
10 SASI_Hs01_00283167 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257090 predicted 218
2 SASI_Hs01_00257091 predicted 219
3 SASI_Hs01_00257092 predicted 228
4 SASI_Hs01_00257093 predicted 228
5 SASI_Hs01_00257094 predicted 363
6 SASI_Hs01_00257095 predicted 358
7 SASI_Hs01_00257096 predicted 372
8 SASI_Hs01_00257097 predicted 223
9 SASI_Hs01_00257098 predicted 222
10 SASI_Hs01_00257099 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282114 predicted 738
2 SASI_Hs01_00282115 predicted 466
3 SASI_Hs01_00282116 predicted 523
4 SASI_Hs01_00282117 predicted 494
5 SASI_Hs01_00282118 predicted 423
6 SASI_Hs01_00282119 predicted 766
7 SASI_Hs01_00282120 predicted 768
8 SASI_Hs01_00282121 predicted 444
9 SASI_Hs01_00282122 predicted 446
10 SASI_Hs01_00282123 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275818 predicted 1209
2 SASI_Hs01_00275819 predicted 986
3 SASI_Hs01_00275820 predicted 1102
4 SASI_Hs01_00275821 predicted 1006
5 SASI_Hs01_00275822 predicted 1480
6 SASI_Hs01_00275823 predicted 959
7 SASI_Hs01_00275824 predicted 1110
8 SASI_Hs01_00275825 predicted 1361
9 SASI_Hs01_00275826 predicted 1461
10 SASI_Hs01_00275827 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100910
VALIDATED
FAM72B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 72, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1034s21c1
Sequence:CCGGCTGAAGGACATCGCATGTTTACTCGAGTAAACATGCGATGTCCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1183s21c1
Sequence:CCGGAGGTGTAAACATCCTACTTTGCTCGAGCAAAGTAGGATGTTTACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1058s21c1
Sequence:CCGGTGTGGGAACATTGTAGGTTATCTCGAGATAACCTACAATGTTCCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1635s21c1
Sequence:CCGGGCCTAGTACCCACGCATATTTCTCGAGAAATATGCGTGGGTACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-867s21c1
Sequence:CCGGTGTCCATCCTGTGTTGCAAATCTCGAGATTTGCAACACAGGATGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100910
VALIDATED
FAM72B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 72, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1034s21c1
Sequence:CCGGCTGAAGGACATCGCATGTTTACTCGAGTAAACATGCGATGTCCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1183s21c1
Sequence:CCGGAGGTGTAAACATCCTACTTTGCTCGAGCAAAGTAGGATGTTTACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1058s21c1
Sequence:CCGGTGTGGGAACATTGTAGGTTATCTCGAGATAACCTACAATGTTCCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1635s21c1
Sequence:CCGGGCCTAGTACCCACGCATATTTCTCGAGAAATATGCGTGGGTACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-867s21c1
Sequence:CCGGTGTCCATCCTGTGTTGCAAATCTCGAGATTTGCAACACAGGATGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100910
VALIDATED
FAM72B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 72, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1034s21c1
Sequence:CCGGCTGAAGGACATCGCATGTTTACTCGAGTAAACATGCGATGTCCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1183s21c1
Sequence:CCGGAGGTGTAAACATCCTACTTTGCTCGAGCAAAGTAGGATGTTTACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1058s21c1
Sequence:CCGGTGTGGGAACATTGTAGGTTATCTCGAGATAACCTACAATGTTCCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-1635s21c1
Sequence:CCGGGCCTAGTACCCACGCATATTTCTCGAGAAATATGCGTGGGTACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100910.1-867s21c1
Sequence:CCGGTGTCCATCCTGTGTTGCAAATCTCGAGATTTGCAACACAGGATGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)