EMAIL THIS PAGE TO A FRIEND

FAM73A

family with sequence similarity 73, member A

154 Gene Product Result for
UniProtKB ID: Q8NAN2, Q6MZG0
Gene ID:
Mouse(215708) family with sequence similarity 73, member A
Rat(362058) family with sequence similarity 73, member A
Zebrafish(450070) family with sequence similarity 73, member A
chicken(771457) family with sequence similarity 73, member A
cow(790477) family with sequence similarity 73, member A
domestic cat(101088943) family with sequence similarity 73, member A
dog(479983) family with sequence similarity 73, member A
sheep(101109140) family with sequence similarity 73, member A
naked mole-rat(101702713) family with sequence similarity 73, member A
domestic guinea pig(100714991) family with sequence similarity 73, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198549 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198549 Rosetta Predictions human pricing
XM_342361 Rosetta Predictions rat pricing
NM_174868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372153 predicted 942
2 SASI_Hs01_00069622 predicted 805
3 SASI_Hs01_00069623 predicted 1041
4 SASI_Hs01_00069624 predicted 357
5 SASI_Hs01_00069625 predicted 949
6 SASI_Hs02_00372154 predicted 731
7 SASI_Hs01_00069626 predicted 473
8 SASI_Hs01_00069627 predicted 698
9 SASI_Hs01_00069628 predicted 1226
10 SASI_Hs02_00372155 predicted 555
11 SASI_Hs01_00069629 predicted 907
12 SASI_Hs01_00069630 predicted 441
13 SASI_Hs01_00069631 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195139 predicted 810
2 SASI_Rn01_00195140 predicted 850
3 SASI_Rn01_00195141 predicted 791
4 SASI_Rn01_00195142 predicted 531
5 SASI_Rn01_00195143 predicted 771
6 SASI_Rn01_00195144 predicted 547
7 SASI_Rn01_00195145 predicted 837
8 SASI_Rn01_00195146 predicted 652
9 SASI_Rn01_00195147 predicted 710
10 SASI_Rn01_00195148 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045863 predicted 1323
2 SASI_Mm01_00045864 predicted 1023
3 SASI_Mm01_00045866 predicted 845
4 SASI_Mm01_00045867 predicted 1714
5 SASI_Mm01_00045868 predicted 1424
6 SASI_Mm01_00045869 predicted 874
7 SASI_Mm01_00045870 predicted 1038
8 SASI_Mm02_00345513 predicted 2132
9 SASI_Mm01_00045871 predicted 656
10 SASI_Mm02_00345514 predicted 1476
11 SASI_Mm01_00045862 predicted 1332
12 SASI_Mm01_00045865 predicted 1130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174868
FAM73A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 73, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.3-662s1c1
Sequence:CCGGGAATCTGACCTTGTCGTTAAGCTCGAGCTTAACGACAAGGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.3-1023s1c1
Sequence:CCGGGAAAGTGTGGATGATATTATTCTCGAGAATAATATCATCCACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174868.3-4426s1c1
Sequence:CCGGCTATGTTCTTGTTCAACTAAACTCGAGTTTAGTTGAACAAGAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.2-705s1c1
Sequence:CCGGCCAAGGAGAAAGGATCTCAGTCTCGAGACTGAGATCCTTTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174868.2-2661s1c1
Sequence:CCGGGCTTGTCTGTTTGCTAATGTACTCGAGTACATTAGCAAACAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-911s1c1
Sequence:CCGGCTGATGGGTATGGAATTATTTCTCGAGAAATAATTCCATACCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-1547s1c1
Sequence:CCGGGCACGGAAGAATCCAAAGAAACTCGAGTTTCTTTGGATTCTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-923s1c1
Sequence:CCGGGAATTATTTGAAGAGGCGTTACTCGAGTAACGCCTCTTCAAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-1158s1c1
Sequence:CCGGCCATTGCAAATGATACTGATACTCGAGTATCAGTATCATTTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174868
FAM73A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 73, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.3-662s1c1
Sequence:CCGGGAATCTGACCTTGTCGTTAAGCTCGAGCTTAACGACAAGGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.3-1023s1c1
Sequence:CCGGGAAAGTGTGGATGATATTATTCTCGAGAATAATATCATCCACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174868.3-4426s1c1
Sequence:CCGGCTATGTTCTTGTTCAACTAAACTCGAGTTTAGTTGAACAAGAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.2-705s1c1
Sequence:CCGGCCAAGGAGAAAGGATCTCAGTCTCGAGACTGAGATCCTTTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174868.2-2661s1c1
Sequence:CCGGGCTTGTCTGTTTGCTAATGTACTCGAGTACATTAGCAAACAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-911s1c1
Sequence:CCGGCTGATGGGTATGGAATTATTTCTCGAGAAATAATTCCATACCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-1547s1c1
Sequence:CCGGGCACGGAAGAATCCAAAGAAACTCGAGTTTCTTTGGATTCTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-923s1c1
Sequence:CCGGGAATTATTTGAAGAGGCGTTACTCGAGTAACGCCTCTTCAAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-1158s1c1
Sequence:CCGGCCATTGCAAATGATACTGATACTCGAGTATCAGTATCATTTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174868
FAM73A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 73, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.3-662s1c1
Sequence:CCGGGAATCTGACCTTGTCGTTAAGCTCGAGCTTAACGACAAGGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.3-1023s1c1
Sequence:CCGGGAAAGTGTGGATGATATTATTCTCGAGAATAATATCATCCACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174868.3-4426s1c1
Sequence:CCGGCTATGTTCTTGTTCAACTAAACTCGAGTTTAGTTGAACAAGAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174868.2-705s1c1
Sequence:CCGGCCAAGGAGAAAGGATCTCAGTCTCGAGACTGAGATCCTTTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174868.2-2661s1c1
Sequence:CCGGGCTTGTCTGTTTGCTAATGTACTCGAGTACATTAGCAAACAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-911s1c1
Sequence:CCGGCTGATGGGTATGGAATTATTTCTCGAGAAATAATTCCATACCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-1547s1c1
Sequence:CCGGGCACGGAAGAATCCAAAGAAACTCGAGTTTCTTTGGATTCTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-923s1c1
Sequence:CCGGGAATTATTTGAAGAGGCGTTACTCGAGTAACGCCTCTTCAAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174868.2-1158s1c1
Sequence:CCGGCCATTGCAAATGATACTGATACTCGAGTATCAGTATCATTTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198549
VALIDATED
FAM73A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 73, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198549.1-1188s1c1
Sequence:CCGGGCCAAACTTCACTGTATTCGACTCGAGTCGAATACAGTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-2191s1c1
Sequence:CCGGCGCTTGAATTGAAGCCAATATCTCGAGATATTGGCTTCAATTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198549.1-195s1c1
Sequence:CCGGCTTCCTCTGACTTGGTACTATCTCGAGATAGTACCAAGTCAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-4435s1c1
Sequence:CCGGCGTGCATTTCATTACCATGTACTCGAGTACATGGTAATGAAATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-1762s1c1
Sequence:CCGGGCTATTCAAGTACAGAGACTTCTCGAGAAGTCTCTGTACTTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198549
VALIDATED
FAM73A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 73, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198549.1-1188s1c1
Sequence:CCGGGCCAAACTTCACTGTATTCGACTCGAGTCGAATACAGTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-2191s1c1
Sequence:CCGGCGCTTGAATTGAAGCCAATATCTCGAGATATTGGCTTCAATTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198549.1-195s1c1
Sequence:CCGGCTTCCTCTGACTTGGTACTATCTCGAGATAGTACCAAGTCAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-4435s1c1
Sequence:CCGGCGTGCATTTCATTACCATGTACTCGAGTACATGGTAATGAAATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-1762s1c1
Sequence:CCGGGCTATTCAAGTACAGAGACTTCTCGAGAAGTCTCTGTACTTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198549
VALIDATED
FAM73A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 73, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198549.1-1188s1c1
Sequence:CCGGGCCAAACTTCACTGTATTCGACTCGAGTCGAATACAGTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-2191s1c1
Sequence:CCGGCGCTTGAATTGAAGCCAATATCTCGAGATATTGGCTTCAATTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198549.1-195s1c1
Sequence:CCGGCTTCCTCTGACTTGGTACTATCTCGAGATAGTACCAAGTCAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-4435s1c1
Sequence:CCGGCGTGCATTTCATTACCATGTACTCGAGTACATGGTAATGAAATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_198549.1-1762s1c1
Sequence:CCGGGCTATTCAAGTACAGAGACTTCTCGAGAAGTCTCTGTACTTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks