EMAIL THIS PAGE TO A FRIEND

FAM73B

family with sequence similarity 73, member B

160 Gene Product Result for
Synonyms: C9orf54
UniProtKB ID: Q7L4E1, Q8NBM3, Q8TEJ6, Q969E6
Gene ID:
Mouse(108958) family with sequence similarity 73, member B
Rat(296623) family with sequence similarity 73, member B
domestic guinea pig(100736023) family with sequence similarity 73, member B
naked mole-rat(101709149) family with sequence similarity 73, member B
sheep(101116032) family with sequence similarity 73, member B
Zebrafish(541431) family with sequence similarity 73, member B
cow(535315) family with sequence similarity 73, member B
domestic cat(101083979) family with sequence similarity 73, member B
dog(491305) family with sequence similarity 73, member B
chicken(427765) family with sequence similarity 73, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032809 Rosetta Predictions human pricing
NM_001106566 Rosetta Predictions rat pricing
NM_175392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033476 predicted 1099
2 SASI_Hs01_00033477 predicted 279
3 SASI_Hs01_00033478 predicted 2433
4 SASI_Hs01_00033479 predicted 1759
5 SASI_Hs01_00033480 predicted 260
6 SASI_Hs02_00360378 predicted 1777
7 SASI_Hs01_00033482 predicted 1742
8 SASI_Hs01_00033483 predicted 2362
9 SASI_Hs01_00033484 predicted 1801
10 SASI_Hs01_00033485 predicted 1797
11 SASI_Hs01_00033481 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220218 predicted 1101
2 SASI_Rn02_00220219 predicted 1283
3 SASI_Rn02_00220220 predicted 1010
4 SASI_Rn02_00220221 predicted 1171
5 SASI_Rn02_00220222 predicted 1334
6 SASI_Rn02_00220223 predicted 1641
7 SASI_Rn02_00220224 predicted 1784
8 SASI_Rn02_00220225 predicted 241
9 SASI_Rn02_00220226 predicted 840
10 SASI_Rn02_00220227 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088481 predicted 2183
2 SASI_Mm01_00088482 predicted 2197
3 SASI_Mm01_00088483 predicted 1929
4 SASI_Mm01_00088484 predicted 1883
5 SASI_Mm01_00088485 predicted 2096
6 SASI_Mm01_00088486 predicted 1950
7 SASI_Mm01_00088487 predicted 1694
8 SASI_Mm01_00088488 predicted 2090
9 SASI_Mm01_00088489 predicted 1939
10 SASI_Mm01_00088490 predicted 2201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175392
VALIDATED
FAM73B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 73, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175392.3-3344s1c1
Sequence:CCGGGTCTTGACATTCCATTCATTTCTCGAGAAATGAATGGAATGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175392.3-1945s1c1
Sequence:CCGGGCTTTCTTCAAGCACCAGATTCTCGAGAATCTGGTGCTTGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175392.3-722s1c1
Sequence:CCGGGCAAGAGCAACGACACTCTTACTCGAGTAAGAGTGTCGTTGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-1168s21c1
Sequence:CCGGGATCTTGAGAGGACCCTAATGCTCGAGCATTAGGGTCCTCTCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-3344s21c1
Sequence:CCGGGTCTTGACATTCCATTCATTTCTCGAGAAATGAATGGAATGTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-798s21c1
Sequence:CCGGCTCGATGGTAGTGGTCAATTCCTCGAGGAATTGACCACTACCATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-2099s21c1
Sequence:CCGGCTAGTAGCATCGGGCTGAATGCTCGAGCATTCAGCCCGATGCTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175392.3-1869s21c1
Sequence:CCGGCTCCGTATCGGAGCATGTTAGCTCGAGCTAACATGCTCCGATACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175392
VALIDATED
FAM73B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 73, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175392.3-3344s1c1
Sequence:CCGGGTCTTGACATTCCATTCATTTCTCGAGAAATGAATGGAATGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175392.3-1945s1c1
Sequence:CCGGGCTTTCTTCAAGCACCAGATTCTCGAGAATCTGGTGCTTGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175392.3-722s1c1
Sequence:CCGGGCAAGAGCAACGACACTCTTACTCGAGTAAGAGTGTCGTTGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-1168s21c1
Sequence:CCGGGATCTTGAGAGGACCCTAATGCTCGAGCATTAGGGTCCTCTCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-3344s21c1
Sequence:CCGGGTCTTGACATTCCATTCATTTCTCGAGAAATGAATGGAATGTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-798s21c1
Sequence:CCGGCTCGATGGTAGTGGTCAATTCCTCGAGGAATTGACCACTACCATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-2099s21c1
Sequence:CCGGCTAGTAGCATCGGGCTGAATGCTCGAGCATTCAGCCCGATGCTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175392.3-1869s21c1
Sequence:CCGGCTCCGTATCGGAGCATGTTAGCTCGAGCTAACATGCTCCGATACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175392
VALIDATED
FAM73B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 73, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175392.3-3344s1c1
Sequence:CCGGGTCTTGACATTCCATTCATTTCTCGAGAAATGAATGGAATGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175392.3-1945s1c1
Sequence:CCGGGCTTTCTTCAAGCACCAGATTCTCGAGAATCTGGTGCTTGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175392.3-722s1c1
Sequence:CCGGGCAAGAGCAACGACACTCTTACTCGAGTAAGAGTGTCGTTGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-1168s21c1
Sequence:CCGGGATCTTGAGAGGACCCTAATGCTCGAGCATTAGGGTCCTCTCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-3344s21c1
Sequence:CCGGGTCTTGACATTCCATTCATTTCTCGAGAAATGAATGGAATGTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-798s21c1
Sequence:CCGGCTCGATGGTAGTGGTCAATTCCTCGAGGAATTGACCACTACCATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175392.3-2099s21c1
Sequence:CCGGCTAGTAGCATCGGGCTGAATGCTCGAGCATTCAGCCCGATGCTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175392.3-1869s21c1
Sequence:CCGGCTCCGTATCGGAGCATGTTAGCTCGAGCTAACATGCTCCGATACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032809
FAM73B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 73, member B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-1649s1c1
Sequence:CCGGCTGATGGCTTCATCTCCCATTCTCGAGAATGGGAGATGAAGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-1279s1c1
Sequence:CCGGGAAGACAAGAGTAACCAGCTTCTCGAGAAGCTGGTTACTCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032809.2-2857s1c1
Sequence:CCGGGCCTTCAGTTCAACGCACAAACTCGAGTTTGTGCGTTGAACTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-477s1c1
Sequence:CCGGCCCTTCAGTGAAGAAAGGATACTCGAGTATCCTTTCTTCACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-482s1c1
Sequence:CCGGCAGTGAAGAAAGGATACTCCACTCGAGTGGAGTATCCTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-287s21c1
Sequence:CCGGCATTCTCCCAGCTACGGTTGACTCGAGTCAACCGTAGCTGGGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1803s21c1
Sequence:CCGGCAATGTGCGCTACACGTCACTCTCGAGAGTGACGTGTAGCGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1045s21c1
Sequence:CCGGCTGACTTCAGAGGATTCCTTCCTCGAGGAAGGAATCCTCTGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-257s21c1
Sequence:CCGGTGTTCCTGTACACGACGTTTGCTCGAGCAAACGTCGTGTACAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-699s21c1
Sequence:CCGGCAATGCAGAGAGCCTGTACATCTCGAGATGTACAGGCTCTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032809.2-2426s21c1
Sequence:CCGGCCTTCTCAGAGAGTTTGCAACCTCGAGGTTGCAAACTCTCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1737s21c1
Sequence:CCGGTGCTGAAGTCTGTGCTTTCTTCTCGAGAAGAAAGCACAGACTTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1322s21c1
Sequence:CCGGAGATGGTGACAGGCCTGATGACTCGAGTCATCAGGCCTGTCACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1774s21c1
Sequence:CCGGCAGTACCTGAGGGACATGTTCCTCGAGGAACATGTCCCTCAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032809
FAM73B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 73, member B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-1649s1c1
Sequence:CCGGCTGATGGCTTCATCTCCCATTCTCGAGAATGGGAGATGAAGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-1279s1c1
Sequence:CCGGGAAGACAAGAGTAACCAGCTTCTCGAGAAGCTGGTTACTCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032809.2-2857s1c1
Sequence:CCGGGCCTTCAGTTCAACGCACAAACTCGAGTTTGTGCGTTGAACTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-477s1c1
Sequence:CCGGCCCTTCAGTGAAGAAAGGATACTCGAGTATCCTTTCTTCACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-482s1c1
Sequence:CCGGCAGTGAAGAAAGGATACTCCACTCGAGTGGAGTATCCTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-287s21c1
Sequence:CCGGCATTCTCCCAGCTACGGTTGACTCGAGTCAACCGTAGCTGGGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1803s21c1
Sequence:CCGGCAATGTGCGCTACACGTCACTCTCGAGAGTGACGTGTAGCGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1045s21c1
Sequence:CCGGCTGACTTCAGAGGATTCCTTCCTCGAGGAAGGAATCCTCTGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-257s21c1
Sequence:CCGGTGTTCCTGTACACGACGTTTGCTCGAGCAAACGTCGTGTACAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-699s21c1
Sequence:CCGGCAATGCAGAGAGCCTGTACATCTCGAGATGTACAGGCTCTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032809.2-2426s21c1
Sequence:CCGGCCTTCTCAGAGAGTTTGCAACCTCGAGGTTGCAAACTCTCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1737s21c1
Sequence:CCGGTGCTGAAGTCTGTGCTTTCTTCTCGAGAAGAAAGCACAGACTTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1322s21c1
Sequence:CCGGAGATGGTGACAGGCCTGATGACTCGAGTCATCAGGCCTGTCACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1774s21c1
Sequence:CCGGCAGTACCTGAGGGACATGTTCCTCGAGGAACATGTCCCTCAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032809
FAM73B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 73, member B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-1649s1c1
Sequence:CCGGCTGATGGCTTCATCTCCCATTCTCGAGAATGGGAGATGAAGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-1279s1c1
Sequence:CCGGGAAGACAAGAGTAACCAGCTTCTCGAGAAGCTGGTTACTCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032809.2-2857s1c1
Sequence:CCGGGCCTTCAGTTCAACGCACAAACTCGAGTTTGTGCGTTGAACTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-477s1c1
Sequence:CCGGCCCTTCAGTGAAGAAAGGATACTCGAGTATCCTTTCTTCACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032809.2-482s1c1
Sequence:CCGGCAGTGAAGAAAGGATACTCCACTCGAGTGGAGTATCCTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-287s21c1
Sequence:CCGGCATTCTCCCAGCTACGGTTGACTCGAGTCAACCGTAGCTGGGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1803s21c1
Sequence:CCGGCAATGTGCGCTACACGTCACTCTCGAGAGTGACGTGTAGCGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1045s21c1
Sequence:CCGGCTGACTTCAGAGGATTCCTTCCTCGAGGAAGGAATCCTCTGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-257s21c1
Sequence:CCGGTGTTCCTGTACACGACGTTTGCTCGAGCAAACGTCGTGTACAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-699s21c1
Sequence:CCGGCAATGCAGAGAGCCTGTACATCTCGAGATGTACAGGCTCTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032809.2-2426s21c1
Sequence:CCGGCCTTCTCAGAGAGTTTGCAACCTCGAGGTTGCAAACTCTCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1737s21c1
Sequence:CCGGTGCTGAAGTCTGTGCTTTCTTCTCGAGAAGAAAGCACAGACTTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1322s21c1
Sequence:CCGGAGATGGTGACAGGCCTGATGACTCGAGTCATCAGGCCTGTCACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032809.2-1774s21c1
Sequence:CCGGCAGTACCTGAGGGACATGTTCCTCGAGGAACATGTCCCTCAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks