EMAIL THIS PAGE TO A FRIEND

FAM74A1

family with sequence similarity 74, member A1

Species: Human FAM74A1(401507)
UniProtKB ID: Q5RGS3, A6NK17
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012278 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012278 Rosetta Predictions human pricing
XR_040320 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232547 predicted 318
2 SASI_Hs01_00232548 predicted 420
3 SASI_Hs01_00232549 predicted 380
4 SASI_Hs01_00232550 predicted 304
5 SASI_Hs01_00232551 predicted 385
6 SASI_Hs01_00232552 predicted 407
7 SASI_Hs01_00232553 predicted 376
8 SASI_Hs01_00232554 predicted 343
9 SASI_Hs01_00232555 predicted 251
10 SASI_Hs01_00232556 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517814 predicted 767
2 SASI_Hs02_00517815 predicted 715
3 SASI_Hs02_00517816 predicted 801
4 SASI_Hs02_00517817 predicted 763
5 SASI_Hs02_00517818 predicted 676
6 SASI_Hs02_00517819 predicted 674
7 SASI_Hs02_00517820 predicted 705
8 SASI_Hs02_00517821 predicted 736
9 SASI_Hs02_00517822 predicted 831
10 SASI_Hs02_00517823 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012278
FAM74A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 74, member A1
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000167598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012278.1-1258s1c1
Sequence:CCGGGATACTACTTTCTAGCTAGAACTCGAGTTCTAGCTAGAAAGTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012278
FAM74A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 74, member A1
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000167598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012278.1-1258s1c1
Sequence:CCGGGATACTACTTTCTAGCTAGAACTCGAGTTCTAGCTAGAAAGTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012278
FAM74A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 74, member A1
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000167598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012278.1-1258s1c1
Sequence:CCGGGATACTACTTTCTAGCTAGAACTCGAGTTCTAGCTAGAAAGTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks