EMAIL THIS PAGE TO A FRIEND

FAM74A3

family with sequence similarity 74, member A3

Species: Human FAM74A3(728495)
UniProtKB ID: Q4VXF1
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098718 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098718 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319731 predicted 299
2 SASI_Hs02_00319732 predicted 298
3 SASI_Hs02_00319733 predicted 296
4 SASI_Hs02_00319734 predicted 304
5 SASI_Hs02_00319735 predicted 506
6 SASI_Hs02_00319736 predicted 502
7 SASI_Hs02_00319737 predicted 449
8 SASI_Hs02_00319738 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098718
FAM74A3 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 74, member A3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-492s21c1
Sequence:CCGGAGACATGGAGAGAGCTCAAAGCTCGAGCTTTGAGCTCTCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098718.1-702s21c1
Sequence:CCGGCAGTCTCCCACATCCGAAATTCTCGAGAATTTCGGATGTGGGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-623s21c1
Sequence:CCGGTCACAGTCAAGCACCTATTTACTCGAGTAAATAGGTGCTTGACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-582s21c1
Sequence:CCGGGGATAATTATTGCCATCAATTCTCGAGAATTGATGGCAATAATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-657s21c1
Sequence:CCGGTCCTTAAGTAAGTCATATTTGCTCGAGCAAATATGACTTACTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098718
FAM74A3 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 74, member A3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-492s21c1
Sequence:CCGGAGACATGGAGAGAGCTCAAAGCTCGAGCTTTGAGCTCTCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098718.1-702s21c1
Sequence:CCGGCAGTCTCCCACATCCGAAATTCTCGAGAATTTCGGATGTGGGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-623s21c1
Sequence:CCGGTCACAGTCAAGCACCTATTTACTCGAGTAAATAGGTGCTTGACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-582s21c1
Sequence:CCGGGGATAATTATTGCCATCAATTCTCGAGAATTGATGGCAATAATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-657s21c1
Sequence:CCGGTCCTTAAGTAAGTCATATTTGCTCGAGCAAATATGACTTACTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098718
FAM74A3 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 74, member A3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-492s21c1
Sequence:CCGGAGACATGGAGAGAGCTCAAAGCTCGAGCTTTGAGCTCTCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098718.1-702s21c1
Sequence:CCGGCAGTCTCCCACATCCGAAATTCTCGAGAATTTCGGATGTGGGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-623s21c1
Sequence:CCGGTCACAGTCAAGCACCTATTTACTCGAGTAAATAGGTGCTTGACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-582s21c1
Sequence:CCGGGGATAATTATTGCCATCAATTCTCGAGAATTGATGGCAATAATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098718.1-657s21c1
Sequence:CCGGTCCTTAAGTAAGTCATATTTGCTCGAGCAAATATGACTTACTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks