EMAIL THIS PAGE TO A FRIEND

FAM74A4

family with sequence similarity 74, member A4

Species: Human FAM74A4(401508)
UniProtKB ID: Q5TZK3, A6NH89, Q6ZSU6
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207507 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207507 Rosetta Predictions human pricing
XR_040321 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178445 predicted 319
2 SASI_Hs01_00178446 predicted 478
3 SASI_Hs01_00178447 predicted 297
4 SASI_Hs01_00178448 predicted 383
5 SASI_Hs01_00178449 predicted 481
6 SASI_Hs01_00178450 predicted 375
7 SASI_Hs01_00178451 predicted 422
8 SASI_Hs01_00178452 predicted 343
9 SASI_Hs01_00178453 predicted 252
10 SASI_Hs01_00178454 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517824 predicted 451
2 SASI_Hs02_00517825 predicted 612
3 SASI_Hs02_00517826 predicted 435
4 SASI_Hs02_00517827 predicted 509
5 SASI_Hs02_00517828 predicted 614
6 SASI_Hs02_00517829 predicted 510
7 SASI_Hs02_00517830 predicted 554
8 SASI_Hs02_00517831 predicted 477
9 SASI_Hs02_00517832 predicted 382
10 SASI_Hs02_00517833 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207507
FAM74A4 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 74, member A4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-490s1c1
Sequence:CCGGCCACAAGAAGATGTGGAGAGACTCGAGTCTCTCCACATCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-480s1c1
Sequence:CCGGCAAAGGCTGTCCACAAGAAGACTCGAGTCTTCTTGTGGACAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-1244s1c1
Sequence:CCGGCACATGCTTATGGCAATAAATCTCGAGATTTATTGCCATAAGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-584s1c1
Sequence:CCGGCAGGTGTTAAATCACAGTCAACTCGAGTTGACTGTGATTTAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-605s1c1
Sequence:CCGGGCACCTATTTACCTAGTGGTACTCGAGTACCACTAGGTAAATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-493s1c1
Sequence:CCGGCAAGAAGATGTGGAGAGAGTTCTCGAGAACTCTCTCCACATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-425s1c1
Sequence:CCGGCAAGAAGACGTGCAGAGAGTTCTCGAGAACTCTCTGCACGTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-355s1c1
Sequence:CCGGGACGTGGAAAGAGCTCAGAAACTCGAGTTTCTGAGCTCTTTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-365s1c1
Sequence:CCGGGAGCTCAGAAACTCAGAGACTCTCGAGAGTCTCTGAGTTTCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-462s1c1
Sequence:CCGGGAAGACATGGAGAGAGCTCAACTCGAGTTGAGCTCTCTCCATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-925s1c1
Sequence:CCGGGCTGAGGCAGAAGAATCACTTCTCGAGAAGTGATTCTTCTGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-367s1c1
Sequence:CCGGGCTCAGAAACTCAGAGACTGTCTCGAGACAGTCTCTGAGTTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207507
FAM74A4 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 74, member A4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-490s1c1
Sequence:CCGGCCACAAGAAGATGTGGAGAGACTCGAGTCTCTCCACATCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-480s1c1
Sequence:CCGGCAAAGGCTGTCCACAAGAAGACTCGAGTCTTCTTGTGGACAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-1244s1c1
Sequence:CCGGCACATGCTTATGGCAATAAATCTCGAGATTTATTGCCATAAGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-584s1c1
Sequence:CCGGCAGGTGTTAAATCACAGTCAACTCGAGTTGACTGTGATTTAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-605s1c1
Sequence:CCGGGCACCTATTTACCTAGTGGTACTCGAGTACCACTAGGTAAATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-493s1c1
Sequence:CCGGCAAGAAGATGTGGAGAGAGTTCTCGAGAACTCTCTCCACATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-425s1c1
Sequence:CCGGCAAGAAGACGTGCAGAGAGTTCTCGAGAACTCTCTGCACGTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-355s1c1
Sequence:CCGGGACGTGGAAAGAGCTCAGAAACTCGAGTTTCTGAGCTCTTTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-365s1c1
Sequence:CCGGGAGCTCAGAAACTCAGAGACTCTCGAGAGTCTCTGAGTTTCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-462s1c1
Sequence:CCGGGAAGACATGGAGAGAGCTCAACTCGAGTTGAGCTCTCTCCATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-925s1c1
Sequence:CCGGGCTGAGGCAGAAGAATCACTTCTCGAGAAGTGATTCTTCTGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-367s1c1
Sequence:CCGGGCTCAGAAACTCAGAGACTGTCTCGAGACAGTCTCTGAGTTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207507
FAM74A4 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 74, member A4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-490s1c1
Sequence:CCGGCCACAAGAAGATGTGGAGAGACTCGAGTCTCTCCACATCTTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-480s1c1
Sequence:CCGGCAAAGGCTGTCCACAAGAAGACTCGAGTCTTCTTGTGGACAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-1244s1c1
Sequence:CCGGCACATGCTTATGGCAATAAATCTCGAGATTTATTGCCATAAGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-584s1c1
Sequence:CCGGCAGGTGTTAAATCACAGTCAACTCGAGTTGACTGTGATTTAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-605s1c1
Sequence:CCGGGCACCTATTTACCTAGTGGTACTCGAGTACCACTAGGTAAATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-493s1c1
Sequence:CCGGCAAGAAGATGTGGAGAGAGTTCTCGAGAACTCTCTCCACATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-425s1c1
Sequence:CCGGCAAGAAGACGTGCAGAGAGTTCTCGAGAACTCTCTGCACGTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-355s1c1
Sequence:CCGGGACGTGGAAAGAGCTCAGAAACTCGAGTTTCTGAGCTCTTTCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-365s1c1
Sequence:CCGGGAGCTCAGAAACTCAGAGACTCTCGAGAGTCTCTGAGTTTCTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-462s1c1
Sequence:CCGGGAAGACATGGAGAGAGCTCAACTCGAGTTGAGCTCTCTCCATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207507.1-925s1c1
Sequence:CCGGGCTGAGGCAGAAGAATCACTTCTCGAGAAGTGATTCTTCTGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207507.1-367s1c1
Sequence:CCGGGCTCAGAAACTCAGAGACTGTCTCGAGACAGTCTCTGAGTTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks