EMAIL THIS PAGE TO A FRIEND

FAM76A

family with sequence similarity 76, member A

120 Gene Product Result for
UniProtKB ID: Q8TAV0, B4DWT3, O95565, O95566, Q8N7J5
Gene ID:
Mouse(230789) family with sequence similarity 76, member A
Rat(362618) family with sequence similarity 76, member A
chicken(426384) family with sequence similarity 76, member A
dog(478169) family with sequence similarity 76, member A
cow(535402) family with sequence similarity 76, member A
domestic cat(101090373) family with sequence similarity 76, member A
sheep(101105983) family with sequence similarity 76, member A
naked mole-rat(101705660) family with sequence similarity 76, member A
domestic guinea pig(100722357) family with sequence similarity 76, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086311 MISSION® esiRNA esiRNA human FAM76A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152660 Rosetta Predictions human pricing
NM_001108686 Rosetta Predictions rat pricing
NM_145553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123069 predicted 599
2 SASI_Hs01_00123071 predicted 448
3 SASI_Hs01_00123072 predicted 762
4 SASI_Hs01_00123073 predicted 386
5 SASI_Hs01_00123074 predicted 670
6 SASI_Hs01_00123075 predicted 991
7 SASI_Hs01_00123076 predicted 671
8 SASI_Hs01_00123077 predicted 678
9 SASI_Hs02_00366552 predicted 506
10 SASI_Hs01_00123078 predicted 660
11 SASI_Hs01_00123070 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241075 predicted 738
2 SASI_Rn02_00241076 predicted 594
3 SASI_Rn02_00241077 predicted 1115
4 SASI_Rn02_00241078 predicted 242
5 SASI_Rn02_00241079 predicted 490
6 SASI_Rn02_00241080 predicted 364
7 SASI_Rn02_00241081 predicted 277
8 SASI_Rn02_00241082 predicted 813
9 SASI_Rn02_00241083 predicted 1104
10 SASI_Rn02_00241084 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075673 predicted 243
2 SASI_Mm01_00075674 predicted 709
3 SASI_Mm01_00075678 predicted 288
4 SASI_Mm01_00075679 predicted 278
5 SASI_Mm02_00341042 predicted 516
6 SASI_Mm02_00341043 predicted 959
7 SASI_Mm02_00341044 predicted 965
8 SASI_Mm01_00075676 predicted 296
9 SASI_Mm01_00075677 predicted 415
10 SASI_Mm02_00341045 predicted 235
11 SASI_Mm01_00075675 predicted 577
12 SASI_Mm01_00075680 predicted 470
13 SASI_Mm01_00075681 predicted 639
14 SASI_Mm01_00075682 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152660
VALIDATED
FAM76A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 76, member A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-741s1c1
Sequence:CCGGCCACTTTGTCATCATTGCCCACTCGAGTGGGCAATGATGACAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152660.1-1237s1c1
Sequence:CCGGCGCTCTCTTTCTCTCACTATTCTCGAGAATAGTGAGAGAAAGAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152660.1-995s1c1
Sequence:CCGGCAGAGAAGTCAGGAGCTATAACTCGAGTTATAGCTCCTGACTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-396s1c1
Sequence:CCGGCTATTCTTGTGAACAGTGCAACTCGAGTTGCACTGTTCACAAGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-232s1c1
Sequence:CCGGGAGTACCAGCAGGAGAGTAAACTCGAGTTTACTCTCCTGCTGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152660.1-1413s1c1
Sequence:CCGGCCTTCATTGCATCCTGCCATACTCGAGTATGGCAGGATGCAATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152660.1-1238s1c1
Sequence:CCGGGCTCTCTTTCTCTCACTATTACTCGAGTAATAGTGAGAGAAAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-302s21c1
Sequence:CCGGCGCCCAAACCTTGTCAGTATTCTCGAGAATACTGACAAGGTTTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-995s21c1
Sequence:CCGGCAGAGAAGTCAGGAGCTATAACTCGAGTTATAGCTCCTGACTTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152660.1-590s21c1
Sequence:CCGGTGAGTGGTGGTGGCCATTATACTCGAGTATAATGGCCACCACCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152660.1-1239s21c1
Sequence:CCGGCTCTCTTTCTCTCACTATTAGCTCGAGCTAATAGTGAGAGAAAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-232s21c1
Sequence:CCGGGAGTACCAGCAGGAGAGTAAACTCGAGTTTACTCTCCTGCTGGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152660
VALIDATED
FAM76A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 76, member A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-741s1c1
Sequence:CCGGCCACTTTGTCATCATTGCCCACTCGAGTGGGCAATGATGACAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152660.1-1237s1c1
Sequence:CCGGCGCTCTCTTTCTCTCACTATTCTCGAGAATAGTGAGAGAAAGAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152660.1-995s1c1
Sequence:CCGGCAGAGAAGTCAGGAGCTATAACTCGAGTTATAGCTCCTGACTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-396s1c1
Sequence:CCGGCTATTCTTGTGAACAGTGCAACTCGAGTTGCACTGTTCACAAGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-232s1c1
Sequence:CCGGGAGTACCAGCAGGAGAGTAAACTCGAGTTTACTCTCCTGCTGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152660.1-1413s1c1
Sequence:CCGGCCTTCATTGCATCCTGCCATACTCGAGTATGGCAGGATGCAATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152660.1-1238s1c1
Sequence:CCGGGCTCTCTTTCTCTCACTATTACTCGAGTAATAGTGAGAGAAAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-302s21c1
Sequence:CCGGCGCCCAAACCTTGTCAGTATTCTCGAGAATACTGACAAGGTTTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-995s21c1
Sequence:CCGGCAGAGAAGTCAGGAGCTATAACTCGAGTTATAGCTCCTGACTTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152660.1-590s21c1
Sequence:CCGGTGAGTGGTGGTGGCCATTATACTCGAGTATAATGGCCACCACCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152660.1-1239s21c1
Sequence:CCGGCTCTCTTTCTCTCACTATTAGCTCGAGCTAATAGTGAGAGAAAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-232s21c1
Sequence:CCGGGAGTACCAGCAGGAGAGTAAACTCGAGTTTACTCTCCTGCTGGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152660
VALIDATED
FAM76A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 76, member A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-741s1c1
Sequence:CCGGCCACTTTGTCATCATTGCCCACTCGAGTGGGCAATGATGACAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152660.1-1237s1c1
Sequence:CCGGCGCTCTCTTTCTCTCACTATTCTCGAGAATAGTGAGAGAAAGAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152660.1-995s1c1
Sequence:CCGGCAGAGAAGTCAGGAGCTATAACTCGAGTTATAGCTCCTGACTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-396s1c1
Sequence:CCGGCTATTCTTGTGAACAGTGCAACTCGAGTTGCACTGTTCACAAGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152660.1-232s1c1
Sequence:CCGGGAGTACCAGCAGGAGAGTAAACTCGAGTTTACTCTCCTGCTGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152660.1-1413s1c1
Sequence:CCGGCCTTCATTGCATCCTGCCATACTCGAGTATGGCAGGATGCAATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152660.1-1238s1c1
Sequence:CCGGGCTCTCTTTCTCTCACTATTACTCGAGTAATAGTGAGAGAAAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-302s21c1
Sequence:CCGGCGCCCAAACCTTGTCAGTATTCTCGAGAATACTGACAAGGTTTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-995s21c1
Sequence:CCGGCAGAGAAGTCAGGAGCTATAACTCGAGTTATAGCTCCTGACTTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152660.1-590s21c1
Sequence:CCGGTGAGTGGTGGTGGCCATTATACTCGAGTATAATGGCCACCACCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152660.1-1239s21c1
Sequence:CCGGCTCTCTTTCTCTCACTATTAGCTCGAGCTAATAGTGAGAGAAAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152660.1-232s21c1
Sequence:CCGGGAGTACCAGCAGGAGAGTAAACTCGAGTTTACTCTCCTGCTGGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145553
FAM76A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 76, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-172s1c1
Sequence:CCGGCCCTGTTGTGAAGTGTACCTACTCGAGTAGGTACACTTCACAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-773s1c1
Sequence:CCGGCAGAAGGATCAAATGATCCTACTCGAGTAGGATCATTTGATCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-775s1c1
Sequence:CCGGGAAGGATCAAATGATCCTAGACTCGAGTCTAGGATCATTTGATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-248s1c1
Sequence:CCGGGCTCAGAATGTACAGTTGTATCTCGAGATACAACTGTACATTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-643s1c1
Sequence:CCGGGTTTGAGTCAATCACAACTAACTCGAGTTAGTTGTGATTGACTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145553
FAM76A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 76, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-172s1c1
Sequence:CCGGCCCTGTTGTGAAGTGTACCTACTCGAGTAGGTACACTTCACAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-773s1c1
Sequence:CCGGCAGAAGGATCAAATGATCCTACTCGAGTAGGATCATTTGATCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-775s1c1
Sequence:CCGGGAAGGATCAAATGATCCTAGACTCGAGTCTAGGATCATTTGATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-248s1c1
Sequence:CCGGGCTCAGAATGTACAGTTGTATCTCGAGATACAACTGTACATTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-643s1c1
Sequence:CCGGGTTTGAGTCAATCACAACTAACTCGAGTTAGTTGTGATTGACTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145553
FAM76A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 76, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-172s1c1
Sequence:CCGGCCCTGTTGTGAAGTGTACCTACTCGAGTAGGTACACTTCACAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-773s1c1
Sequence:CCGGCAGAAGGATCAAATGATCCTACTCGAGTAGGATCATTTGATCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-775s1c1
Sequence:CCGGGAAGGATCAAATGATCCTAGACTCGAGTCTAGGATCATTTGATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-248s1c1
Sequence:CCGGGCTCAGAATGTACAGTTGTATCTCGAGATACAACTGTACATTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145553.1-643s1c1
Sequence:CCGGGTTTGAGTCAATCACAACTAACTCGAGTTAGTTGTGATTGACTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)