EMAIL THIS PAGE TO A FRIEND

FAM76B

family with sequence similarity 76, member B

197 Gene Product Result for
UniProtKB ID: Q5HYJ3, Q6PIU3, Q8TC53
Gene ID:
Mouse(72826) family with sequence similarity 76, member B
Rat(367021) family with sequence similarity 76, member B
domestic guinea pig(100725311) family with sequence similarity 76, member B
naked mole-rat(101717593) family with sequence similarity 76, member B
sheep(101102260) family with sequence similarity 76, member B
Zebrafish(335015) family with sequence similarity 76, member B
cow(519943) family with sequence similarity 76, member B
domestic cat(101080735) family with sequence similarity 76, member B
dog(485117) family with sequence similarity 76, member B
chicken(418994) family with sequence similarity 76, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144664 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144664 Rosetta Predictions human pricing
NM_001108994 Rosetta Predictions rat pricing
NM_176836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135314 predicted 1153
2 SASI_Hs01_00135315 predicted 1080
3 SASI_Hs01_00135313 predicted 1065
4 SASI_Hs01_00135322 predicted 562
5 SASI_Hs02_00364549 predicted 1310
6 SASI_Hs02_00364550 predicted 984
7 SASI_Hs02_00364551 predicted 993
8 SASI_Hs01_00135317 predicted 931
9 SASI_Hs01_00135318 predicted 667
10 SASI_Hs02_00364552 predicted 1273
11 SASI_Hs01_00135316 predicted 900
12 SASI_Hs01_00135319 predicted 502
13 SASI_Hs01_00135320 predicted 839
14 SASI_Hs01_00135321 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244124 predicted 1070
2 SASI_Rn02_00244125 predicted 1044
3 SASI_Rn02_00244126 predicted 1413
4 SASI_Rn02_00244127 predicted 1258
5 SASI_Rn02_00244128 predicted 1064
6 SASI_Rn02_00244129 predicted 1383
7 SASI_Rn02_00244130 predicted 996
8 SASI_Rn02_00244131 predicted 302
9 SASI_Rn02_00244132 predicted 1255
10 SASI_Rn02_00244133 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137869 predicted 466
2 SASI_Mm01_00137870 predicted 1012
3 SASI_Mm01_00137871 predicted 1038
4 SASI_Mm01_00137872 predicted 1157
5 SASI_Mm01_00137873 predicted 1356
6 SASI_Mm01_00137874 predicted 1020
7 SASI_Mm01_00137877 predicted 380
8 SASI_Mm01_00137875 predicted 455
9 SASI_Mm01_00137876 predicted 325
10 SASI_Mm01_00137878 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176836
FAM76B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 76, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.3-848s1c1
Sequence:CCGGGTGGAAACAGAGCCATAAATCCTCGAGGATTTATGGCTCTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.2-703s1c1
Sequence:CCGGCACATTCTAACTCCTCATCTTCTCGAGAAGATGAGGAGTTAGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176836.2-2443s1c1
Sequence:CCGGCCGTGCTTATGTCTGAATAATCTCGAGATTATTCAGACATAAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.2-1149s1c1
Sequence:CCGGGCGCACAAAGAAACTGTGGAACTCGAGTTCCACAGTTTCTTTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-1112s1c1
Sequence:CCGGGTCAAATTTGAGGACTAAGATCTCGAGATCTTAGTCCTCAAATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-440s1c1
Sequence:CCGGCAAGCAATTTGGAACACCTAACTCGAGTTAGGTGTTCCAAATTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-1016s1c1
Sequence:CCGGGATGTCACTTAAACGTCTCTTCTCGAGAAGAGACGTTTAAGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-643s1c1
Sequence:CCGGCCTTGTCATACAAGAGAGTTTCTCGAGAAACTCTCTTGTATGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176836.2-2998s1c1
Sequence:CCGGGCTGCATTCATAAAGTCCTTACTCGAGTAAGGACTTTATGAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176836
FAM76B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 76, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.3-848s1c1
Sequence:CCGGGTGGAAACAGAGCCATAAATCCTCGAGGATTTATGGCTCTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.2-703s1c1
Sequence:CCGGCACATTCTAACTCCTCATCTTCTCGAGAAGATGAGGAGTTAGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176836.2-2443s1c1
Sequence:CCGGCCGTGCTTATGTCTGAATAATCTCGAGATTATTCAGACATAAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.2-1149s1c1
Sequence:CCGGGCGCACAAAGAAACTGTGGAACTCGAGTTCCACAGTTTCTTTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-1112s1c1
Sequence:CCGGGTCAAATTTGAGGACTAAGATCTCGAGATCTTAGTCCTCAAATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-440s1c1
Sequence:CCGGCAAGCAATTTGGAACACCTAACTCGAGTTAGGTGTTCCAAATTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-1016s1c1
Sequence:CCGGGATGTCACTTAAACGTCTCTTCTCGAGAAGAGACGTTTAAGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-643s1c1
Sequence:CCGGCCTTGTCATACAAGAGAGTTTCTCGAGAAACTCTCTTGTATGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176836.2-2998s1c1
Sequence:CCGGGCTGCATTCATAAAGTCCTTACTCGAGTAAGGACTTTATGAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176836
FAM76B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 76, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.3-848s1c1
Sequence:CCGGGTGGAAACAGAGCCATAAATCCTCGAGGATTTATGGCTCTGTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.2-703s1c1
Sequence:CCGGCACATTCTAACTCCTCATCTTCTCGAGAAGATGAGGAGTTAGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176836.2-2443s1c1
Sequence:CCGGCCGTGCTTATGTCTGAATAATCTCGAGATTATTCAGACATAAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176836.2-1149s1c1
Sequence:CCGGGCGCACAAAGAAACTGTGGAACTCGAGTTCCACAGTTTCTTTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-1112s1c1
Sequence:CCGGGTCAAATTTGAGGACTAAGATCTCGAGATCTTAGTCCTCAAATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-440s1c1
Sequence:CCGGCAAGCAATTTGGAACACCTAACTCGAGTTAGGTGTTCCAAATTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-1016s1c1
Sequence:CCGGGATGTCACTTAAACGTCTCTTCTCGAGAAGAGACGTTTAAGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176836.2-643s1c1
Sequence:CCGGCCTTGTCATACAAGAGAGTTTCTCGAGAAACTCTCTTGTATGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176836.2-2998s1c1
Sequence:CCGGGCTGCATTCATAAAGTCCTTACTCGAGTAAGGACTTTATGAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144664
FAM76B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 76, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-358s1c1
Sequence:CCGGCCTTGTCAGTACTGTAACATACTCGAGTATGTTACAGTACTGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-803s1c1
Sequence:CCGGCCAAATTGGAATCTAAGCCATCTCGAGATGGCTTAGATTCCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-531s1c1
Sequence:CCGGGCTCTGTACTTTATCGTACAACTCGAGTTGTACGATAAAGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144664.3-1501s1c1
Sequence:CCGGGCTCTTTATGAAACGCAACATCTCGAGATGTTGCGTTTCATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-1285s1c1
Sequence:CCGGGCCCTTAAATTCTGTGTAGTACTCGAGTACTACACAGAATTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144664.3-3347s1c1
Sequence:CCGGGCTTTGTAAATTCCAAGGCTACTCGAGTAGCCTTGGAATTTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-821s1c1
Sequence:CCGGCATCTAATGGAGATAGGAGTACTCGAGTACTCCTATCTCCATTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144664.3-1163s1c1
Sequence:CCGGGCAGCATTATCAAAGGGTAAACTCGAGTTTACCCTTTGATAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-357s1c1
Sequence:CCGGGCCTTGTCAGTACTGTAACATCTCGAGATGTTACAGTACTGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144664
FAM76B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 76, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-358s1c1
Sequence:CCGGCCTTGTCAGTACTGTAACATACTCGAGTATGTTACAGTACTGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-803s1c1
Sequence:CCGGCCAAATTGGAATCTAAGCCATCTCGAGATGGCTTAGATTCCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-531s1c1
Sequence:CCGGGCTCTGTACTTTATCGTACAACTCGAGTTGTACGATAAAGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144664.3-1501s1c1
Sequence:CCGGGCTCTTTATGAAACGCAACATCTCGAGATGTTGCGTTTCATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-1285s1c1
Sequence:CCGGGCCCTTAAATTCTGTGTAGTACTCGAGTACTACACAGAATTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144664.3-3347s1c1
Sequence:CCGGGCTTTGTAAATTCCAAGGCTACTCGAGTAGCCTTGGAATTTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-821s1c1
Sequence:CCGGCATCTAATGGAGATAGGAGTACTCGAGTACTCCTATCTCCATTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144664.3-1163s1c1
Sequence:CCGGGCAGCATTATCAAAGGGTAAACTCGAGTTTACCCTTTGATAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-357s1c1
Sequence:CCGGGCCTTGTCAGTACTGTAACATCTCGAGATGTTACAGTACTGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144664
FAM76B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 76, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-358s1c1
Sequence:CCGGCCTTGTCAGTACTGTAACATACTCGAGTATGTTACAGTACTGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-803s1c1
Sequence:CCGGCCAAATTGGAATCTAAGCCATCTCGAGATGGCTTAGATTCCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-531s1c1
Sequence:CCGGGCTCTGTACTTTATCGTACAACTCGAGTTGTACGATAAAGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144664.3-1501s1c1
Sequence:CCGGGCTCTTTATGAAACGCAACATCTCGAGATGTTGCGTTTCATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144664.3-1285s1c1
Sequence:CCGGGCCCTTAAATTCTGTGTAGTACTCGAGTACTACACAGAATTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144664.3-3347s1c1
Sequence:CCGGGCTTTGTAAATTCCAAGGCTACTCGAGTAGCCTTGGAATTTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-821s1c1
Sequence:CCGGCATCTAATGGAGATAGGAGTACTCGAGTACTCCTATCTCCATTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144664.3-1163s1c1
Sequence:CCGGGCAGCATTATCAAAGGGTAAACTCGAGTTTACCCTTTGATAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144664.3-357s1c1
Sequence:CCGGGCCTTGTCAGTACTGTAACATCTCGAGATGTTACAGTACTGACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks