EMAIL THIS PAGE TO A FRIEND

FAM78B

family with sequence similarity 78, member B

52 Gene Product Result for
UniProtKB ID: Q5VT40, B7Z693
Gene ID:
Mouse(226610) family with sequence similarity 78, member B
chicken(769830) family with sequence similarity 78, member B
dog(608943) family with sequence similarity 78, member B
domestic cat(101101540) family with sequence similarity 78, member B
cow(505707) family with sequence similarity 78, member B
domestic guinea pig(100735643) family with sequence similarity 78, member B
naked mole-rat(101719347) family with sequence similarity 78, member B
sheep(101113028) family with sequence similarity 78, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017961 Rosetta Predictions human pricing
NM_175461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021271 predicted 1060
2 SASI_Hs01_00021272 predicted 1171
3 SASI_Hs01_00021273 predicted 801
4 SASI_Hs01_00021274 predicted 1118
5 SASI_Hs01_00021275 predicted 808
6 SASI_Hs01_00021276 predicted 1286
7 SASI_Hs02_00306819 predicted 1358
8 SASI_Hs02_00306820 predicted 921
9 SASI_Hs01_00021278 predicted 796
10 SASI_Hs01_00021279 predicted 1355
11 SASI_Hs01_00021270 predicted 975
12 SASI_Hs01_00021277 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111805 predicted 1079
2 SASI_Mm01_00111806 predicted 674
3 SASI_Mm01_00111807 predicted 1027
4 SASI_Mm01_00111808 predicted 1087
5 SASI_Mm01_00111809 predicted 1240
6 SASI_Mm01_00111810 predicted 1089
7 SASI_Mm01_00111811 predicted 1341
8 SASI_Mm01_00111812 predicted 1244
9 SASI_Mm02_00346364 predicted 1019
10 SASI_Mm02_00346365 predicted 661
11 SASI_Mm01_00111804 predicted 470
12 SASI_Mm01_00111813 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175461
FAM78B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 78, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-564s21c1
Sequence:CCGGCACTGCTCACAAGGATCAAGACTCGAGTCTTGATCCTTGTGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-494s21c1
Sequence:CCGGTCCGTCAGCATGAATGATAACCTCGAGGTTATCATTCATGCTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175461.3-1116s21c1
Sequence:CCGGACCGTGCAAGTAGCCATATTTCTCGAGAAATATGGCTACTTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-858s21c1
Sequence:CCGGTTGTGATACCTCCTAAGTAAACTCGAGTTTACTTAGGAGGTATCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-642s21c1
Sequence:CCGGTCATACTGCAGACCATCAAATCTCGAGATTTGATGGTCTGCAGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-215s1c1
Sequence:CCGGGATGGAGTTCTTCAACACCTACTCGAGTAGGTGTTGAAGAACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-545s1c1
Sequence:CCGGGCAGACCATCAAATGGAGGATCTCGAGATCCTCCATTTGATGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-566s1c1
Sequence:CCGGGAGAGTGGACATTGAAGTGGACTCGAGTCCACTTCAATGTCCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175461
FAM78B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 78, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-564s21c1
Sequence:CCGGCACTGCTCACAAGGATCAAGACTCGAGTCTTGATCCTTGTGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-494s21c1
Sequence:CCGGTCCGTCAGCATGAATGATAACCTCGAGGTTATCATTCATGCTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175461.3-1116s21c1
Sequence:CCGGACCGTGCAAGTAGCCATATTTCTCGAGAAATATGGCTACTTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-858s21c1
Sequence:CCGGTTGTGATACCTCCTAAGTAAACTCGAGTTTACTTAGGAGGTATCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-642s21c1
Sequence:CCGGTCATACTGCAGACCATCAAATCTCGAGATTTGATGGTCTGCAGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-215s1c1
Sequence:CCGGGATGGAGTTCTTCAACACCTACTCGAGTAGGTGTTGAAGAACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-545s1c1
Sequence:CCGGGCAGACCATCAAATGGAGGATCTCGAGATCCTCCATTTGATGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-566s1c1
Sequence:CCGGGAGAGTGGACATTGAAGTGGACTCGAGTCCACTTCAATGTCCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175461
FAM78B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 78, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-564s21c1
Sequence:CCGGCACTGCTCACAAGGATCAAGACTCGAGTCTTGATCCTTGTGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-494s21c1
Sequence:CCGGTCCGTCAGCATGAATGATAACCTCGAGGTTATCATTCATGCTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175461.3-1116s21c1
Sequence:CCGGACCGTGCAAGTAGCCATATTTCTCGAGAAATATGGCTACTTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-858s21c1
Sequence:CCGGTTGTGATACCTCCTAAGTAAACTCGAGTTTACTTAGGAGGTATCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175461.3-642s21c1
Sequence:CCGGTCATACTGCAGACCATCAAATCTCGAGATTTGATGGTCTGCAGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-215s1c1
Sequence:CCGGGATGGAGTTCTTCAACACCTACTCGAGTAGGTGTTGAAGAACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-545s1c1
Sequence:CCGGGCAGACCATCAAATGGAGGATCTCGAGATCCTCCATTTGATGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175461.2-566s1c1
Sequence:CCGGGAGAGTGGACATTGAAGTGGACTCGAGTCCACTTCAATGTCCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017961
FAM78B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 78, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-944s1c1
Sequence:CCGGGCCACTGCTCACAAGAATCAACTCGAGTTGATTCTTGTGAGCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1019s1c1
Sequence:CCGGGAAGATCATTCTGCAGACCATCTCGAGATGGTCTGCAGAATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-856s1c1
Sequence:CCGGCCAACAAGATCTCCAGGTTCTCTCGAGAGAACCTGGAGATCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1001s1c1
Sequence:CCGGGAACACCACCACAAAGGAGAACTCGAGTTCTCCTTTGTGGTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-519s1c1
Sequence:CCGGGAGAACATCGTGGTGTACGATCTCGAGATCGTACACCACGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-967s1c1
Sequence:CCGGGAGACCAAAGTTTCACGACCTCTCGAGAGGTCGTGAAACTTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1335s1c1
Sequence:CCGGCAAACAGAGTTTCTGAGCCAACTCGAGTTGGCTCAGAAACTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-958s1c1
Sequence:CCGGGAATCAAGAGAGACCAAAGTTCTCGAGAACTTTGGTCTCTCTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017961
FAM78B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 78, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-944s1c1
Sequence:CCGGGCCACTGCTCACAAGAATCAACTCGAGTTGATTCTTGTGAGCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1019s1c1
Sequence:CCGGGAAGATCATTCTGCAGACCATCTCGAGATGGTCTGCAGAATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-856s1c1
Sequence:CCGGCCAACAAGATCTCCAGGTTCTCTCGAGAGAACCTGGAGATCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1001s1c1
Sequence:CCGGGAACACCACCACAAAGGAGAACTCGAGTTCTCCTTTGTGGTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-519s1c1
Sequence:CCGGGAGAACATCGTGGTGTACGATCTCGAGATCGTACACCACGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-967s1c1
Sequence:CCGGGAGACCAAAGTTTCACGACCTCTCGAGAGGTCGTGAAACTTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1335s1c1
Sequence:CCGGCAAACAGAGTTTCTGAGCCAACTCGAGTTGGCTCAGAAACTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-958s1c1
Sequence:CCGGGAATCAAGAGAGACCAAAGTTCTCGAGAACTTTGGTCTCTCTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017961
FAM78B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 78, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-944s1c1
Sequence:CCGGGCCACTGCTCACAAGAATCAACTCGAGTTGATTCTTGTGAGCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1019s1c1
Sequence:CCGGGAAGATCATTCTGCAGACCATCTCGAGATGGTCTGCAGAATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-856s1c1
Sequence:CCGGCCAACAAGATCTCCAGGTTCTCTCGAGAGAACCTGGAGATCTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1001s1c1
Sequence:CCGGGAACACCACCACAAAGGAGAACTCGAGTTCTCCTTTGTGGTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-519s1c1
Sequence:CCGGGAGAACATCGTGGTGTACGATCTCGAGATCGTACACCACGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-967s1c1
Sequence:CCGGGAGACCAAAGTTTCACGACCTCTCGAGAGGTCGTGAAACTTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-1335s1c1
Sequence:CCGGCAAACAGAGTTTCTGAGCCAACTCGAGTTGGCTCAGAAACTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017961.1-958s1c1
Sequence:CCGGGAATCAAGAGAGACCAAAGTTCTCGAGAACTTTGGTCTCTCTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks