EMAIL THIS PAGE TO A FRIEND

FAM81A

family with sequence similarity 81, member A

170 Gene Product Result for
UniProtKB ID: Q8TBF8
Gene ID:
Mouse(76886) family with sequence similarity 81, member A
Rat(315789) family with sequence similarity 81, member A
sheep(101115214) family with sequence similarity 81, member A
naked mole-rat(101726196) family with sequence similarity 81, member A
domestic guinea pig(100724347) family with sequence similarity 81, member A
chicken(415396) family with sequence similarity 81, member A
domestic cat(101101388) family with sequence similarity 81, member A
cow(538402) family with sequence similarity 81, member A
dog(478326) family with sequence similarity 81, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152450 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152450 Rosetta Predictions human pricing
NM_001108163 Rosetta Predictions rat pricing
NM_029784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366220 predicted 1183
2 SASI_Hs01_00083610 predicted 867
3 SASI_Hs01_00083611 predicted 466
4 SASI_Hs01_00083612 predicted 528
5 SASI_Hs01_00083613 predicted 442
6 SASI_Hs01_00083614 predicted 830
7 SASI_Hs01_00083615 predicted 893
8 SASI_Hs01_00083616 predicted 520
9 SASI_Hs01_00083617 predicted 1078
10 SASI_Hs01_00083618 predicted 1168
11 SASI_Hs01_00083619 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235974 predicted 1333
2 SASI_Rn02_00235975 predicted 1350
3 SASI_Rn02_00235976 predicted 697
4 SASI_Rn02_00235977 predicted 1349
5 SASI_Rn02_00235978 predicted 1435
6 SASI_Rn02_00235979 predicted 1319
7 SASI_Rn02_00235980 predicted 1321
8 SASI_Rn02_00235981 predicted 1370
9 SASI_Rn02_00235982 predicted 676
10 SASI_Rn02_00235983 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197403 predicted 640
2 SASI_Mm01_00197404 predicted 603
3 SASI_Mm01_00197405 predicted 656
4 SASI_Mm01_00197406 predicted 1177
5 SASI_Mm01_00197407 predicted 962
6 SASI_Mm01_00197409 predicted 1494
7 SASI_Mm01_00197410 predicted 578
8 SASI_Mm01_00197411 predicted 1330
9 SASI_Mm01_00197412 predicted 1105
10 SASI_Mm02_00335930 predicted 1184
11 SASI_Mm01_00197408 predicted 1465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029784
FAM81A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 81, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-1375s1c1
Sequence:CCGGCCAACTTCAGAAGCAGATCCACTCGAGTGGATCTGCTTCTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-1114s1c1
Sequence:CCGGCAATGAAAGAGACGTAGAGAACTCGAGTTCTCTACGTCTCTTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-654s1c1
Sequence:CCGGGCTATGGAACTAATTCTGCCTCTCGAGAGGCAGAATTAGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-584s1c1
Sequence:CCGGGCCATTGTGAAGCAACTGAATCTCGAGATTCAGTTGCTTCACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-797s1c1
Sequence:CCGGCACTTGAACAAGGAACAGCAACTCGAGTTGCTGTTCCTTGTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-550s1c1
Sequence:CCGGGCTGTTCTTGGAAGAGCATATCTCGAGATATGCTCTTCCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1113s1c1
Sequence:CCGGCCAATGAAAGAGACGTAGAGACTCGAGTCTCTACGTCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1277s1c1
Sequence:CCGGGAGATGAAAGCGGAGGTTAATCTCGAGATTAACCTCCGCTTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1043s1c1
Sequence:CCGGGAGCGGATAGAGAAAGAACTTCTCGAGAAGTTCTTTCTCTATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029784
FAM81A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 81, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-1375s1c1
Sequence:CCGGCCAACTTCAGAAGCAGATCCACTCGAGTGGATCTGCTTCTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-1114s1c1
Sequence:CCGGCAATGAAAGAGACGTAGAGAACTCGAGTTCTCTACGTCTCTTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-654s1c1
Sequence:CCGGGCTATGGAACTAATTCTGCCTCTCGAGAGGCAGAATTAGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-584s1c1
Sequence:CCGGGCCATTGTGAAGCAACTGAATCTCGAGATTCAGTTGCTTCACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-797s1c1
Sequence:CCGGCACTTGAACAAGGAACAGCAACTCGAGTTGCTGTTCCTTGTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-550s1c1
Sequence:CCGGGCTGTTCTTGGAAGAGCATATCTCGAGATATGCTCTTCCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1113s1c1
Sequence:CCGGCCAATGAAAGAGACGTAGAGACTCGAGTCTCTACGTCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1277s1c1
Sequence:CCGGGAGATGAAAGCGGAGGTTAATCTCGAGATTAACCTCCGCTTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1043s1c1
Sequence:CCGGGAGCGGATAGAGAAAGAACTTCTCGAGAAGTTCTTTCTCTATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029784
FAM81A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 81, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-1375s1c1
Sequence:CCGGCCAACTTCAGAAGCAGATCCACTCGAGTGGATCTGCTTCTGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-1114s1c1
Sequence:CCGGCAATGAAAGAGACGTAGAGAACTCGAGTTCTCTACGTCTCTTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-654s1c1
Sequence:CCGGGCTATGGAACTAATTCTGCCTCTCGAGAGGCAGAATTAGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-584s1c1
Sequence:CCGGGCCATTGTGAAGCAACTGAATCTCGAGATTCAGTTGCTTCACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029784.1-797s1c1
Sequence:CCGGCACTTGAACAAGGAACAGCAACTCGAGTTGCTGTTCCTTGTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-550s1c1
Sequence:CCGGGCTGTTCTTGGAAGAGCATATCTCGAGATATGCTCTTCCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1113s1c1
Sequence:CCGGCCAATGAAAGAGACGTAGAGACTCGAGTCTCTACGTCTCTTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1277s1c1
Sequence:CCGGGAGATGAAAGCGGAGGTTAATCTCGAGATTAACCTCCGCTTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029784.1-1043s1c1
Sequence:CCGGGAGCGGATAGAGAAAGAACTTCTCGAGAAGTTCTTTCTCTATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152450
FAM81A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 81, member A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-596s1c1
Sequence:CCGGGCAAGATGTGATGCCAGCATACTCGAGTATGCTGGCATCACATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-506s1c1
Sequence:CCGGCGGGACAACATTAGCTATGGACTCGAGTCCATAGCTAATGTTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-1103s1c1
Sequence:CCGGCGAATCACCAAGCTGGAGTTACTCGAGTAACTCCAGCTTGGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152450.1-1179s1c1
Sequence:CCGGCCGTCTATGAAAGCATAGGATCTCGAGATCCTATGCTTTCATAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-1862s1c1
Sequence:CCGGCCACCATTTATGTAATGGAAACTCGAGTTTCCATTACATAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-1968s1c1
Sequence:CCGGCCACCTAGATATTACAGGTTTCTCGAGAAACCTGTAATATCTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-520s1c1
Sequence:CCGGCTATGGAACTAATTCTGCCTTCTCGAGAAGGCAGAATTAGTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152450.1-449s1c1
Sequence:CCGGGCCATAGTGAAGCAACTTAATCTCGAGATTAAGTTGCTTCACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152450.1-1861s1c1
Sequence:CCGGCCCACCATTTATGTAATGGAACTCGAGTTCCATTACATAAATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-687s1c1
Sequence:CCGGCCAAACTTATCTTGGAAACGACTCGAGTCGTTTCCAAGATAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-2271s1c1
Sequence:CCGGCCGTCAGAAGTATGATGTAAACTCGAGTTTACATCATACTTCTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-425s1c1
Sequence:CCGGGAGGAGCATATCAGAAACATACTCGAGTATGTTTCTGATATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-946s1c1
Sequence:CCGGGCTTTCCTTGATTGTTAAGGACTCGAGTCCTTAACAATCAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152450
FAM81A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 81, member A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-596s1c1
Sequence:CCGGGCAAGATGTGATGCCAGCATACTCGAGTATGCTGGCATCACATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-506s1c1
Sequence:CCGGCGGGACAACATTAGCTATGGACTCGAGTCCATAGCTAATGTTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-1103s1c1
Sequence:CCGGCGAATCACCAAGCTGGAGTTACTCGAGTAACTCCAGCTTGGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152450.1-1179s1c1
Sequence:CCGGCCGTCTATGAAAGCATAGGATCTCGAGATCCTATGCTTTCATAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-1862s1c1
Sequence:CCGGCCACCATTTATGTAATGGAAACTCGAGTTTCCATTACATAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-1968s1c1
Sequence:CCGGCCACCTAGATATTACAGGTTTCTCGAGAAACCTGTAATATCTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-520s1c1
Sequence:CCGGCTATGGAACTAATTCTGCCTTCTCGAGAAGGCAGAATTAGTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152450.1-449s1c1
Sequence:CCGGGCCATAGTGAAGCAACTTAATCTCGAGATTAAGTTGCTTCACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152450.1-1861s1c1
Sequence:CCGGCCCACCATTTATGTAATGGAACTCGAGTTCCATTACATAAATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-687s1c1
Sequence:CCGGCCAAACTTATCTTGGAAACGACTCGAGTCGTTTCCAAGATAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-2271s1c1
Sequence:CCGGCCGTCAGAAGTATGATGTAAACTCGAGTTTACATCATACTTCTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-425s1c1
Sequence:CCGGGAGGAGCATATCAGAAACATACTCGAGTATGTTTCTGATATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-946s1c1
Sequence:CCGGGCTTTCCTTGATTGTTAAGGACTCGAGTCCTTAACAATCAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152450
FAM81A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 81, member A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-596s1c1
Sequence:CCGGGCAAGATGTGATGCCAGCATACTCGAGTATGCTGGCATCACATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-506s1c1
Sequence:CCGGCGGGACAACATTAGCTATGGACTCGAGTCCATAGCTAATGTTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-1103s1c1
Sequence:CCGGCGAATCACCAAGCTGGAGTTACTCGAGTAACTCCAGCTTGGTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152450.1-1179s1c1
Sequence:CCGGCCGTCTATGAAAGCATAGGATCTCGAGATCCTATGCTTTCATAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-1862s1c1
Sequence:CCGGCCACCATTTATGTAATGGAAACTCGAGTTTCCATTACATAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-1968s1c1
Sequence:CCGGCCACCTAGATATTACAGGTTTCTCGAGAAACCTGTAATATCTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-520s1c1
Sequence:CCGGCTATGGAACTAATTCTGCCTTCTCGAGAAGGCAGAATTAGTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152450.1-449s1c1
Sequence:CCGGGCCATAGTGAAGCAACTTAATCTCGAGATTAAGTTGCTTCACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152450.1-1861s1c1
Sequence:CCGGCCCACCATTTATGTAATGGAACTCGAGTTCCATTACATAAATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-687s1c1
Sequence:CCGGCCAAACTTATCTTGGAAACGACTCGAGTCGTTTCCAAGATAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152450.1-2271s1c1
Sequence:CCGGCCGTCAGAAGTATGATGTAAACTCGAGTTTACATCATACTTCTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-425s1c1
Sequence:CCGGGAGGAGCATATCAGAAACATACTCGAGTATGTTTCTGATATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152450.1-946s1c1
Sequence:CCGGGCTTTCCTTGATTGTTAAGGACTCGAGTCCTTAACAATCAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks