EMAIL THIS PAGE TO A FRIEND

FAM81B

family with sequence similarity 81, member B

81 Gene Product Result for
UniProtKB ID: Q96LP2
Gene ID:
Mouse(238726) family with sequence similarity 81, member B
Rat(309925) family with sequence similarity 81, member B
chicken(431568) family with sequence similarity 81, member B
cow(514910) family with sequence similarity 81, member B
domestic cat(101081117) family with sequence similarity 81, member B
dog(488905) family with sequence similarity 81, member B
domestic guinea pig(100720668) family with sequence similarity 81, member B
naked mole-rat(101697205) family with sequence similarity 81, member B
sheep(101108829) family with sequence similarity 81, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152548 Rosetta Predictions human pricing
XM_001059199 Rosetta Predictions rat pricing
XM_226608 Rosetta Predictions rat pricing
XM_138722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366352 predicted 1271
2 SASI_Hs01_00063777 predicted 704
3 SASI_Hs01_00063778 predicted 1254
4 SASI_Hs01_00063779 predicted 707
5 SASI_Hs01_00063780 predicted 409
6 SASI_Hs01_00063781 predicted 654
7 SASI_Hs01_00063782 predicted 305
8 SASI_Hs01_00063784 predicted 952
9 SASI_Hs02_00366353 predicted 834
10 SASI_Hs01_00063785 predicted 944
11 SASI_Hs01_00063776 predicted 850
12 SASI_Hs01_00063783 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292350 predicted 351
2 SASI_Rn02_00292351 predicted 449
3 SASI_Rn02_00292352 predicted 913
4 SASI_Rn02_00292353 predicted 951
5 SASI_Rn02_00292354 predicted 611
6 SASI_Rn02_00292355 predicted 843
7 SASI_Rn02_00292356 predicted 800
8 SASI_Rn02_00292357 predicted 595
9 SASI_Rn02_00292358 predicted 313
10 SASI_Rn02_00292359 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383735 predicted 247
2 SASI_Rn02_00383736 predicted 342
3 SASI_Rn02_00383737 predicted 815
4 SASI_Rn02_00383738 predicted 843
5 SASI_Rn02_00383739 predicted 511
6 SASI_Rn02_00383740 predicted 734
7 SASI_Rn02_00383741 predicted 701
8 SASI_Rn02_00383742 predicted 493
9 SASI_Rn02_00383743 predicted 206
10 SASI_Rn02_00383744 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424831 predicted 350
2 SASI_Mm02_00424832 predicted 271
3 SASI_Mm02_00424833 predicted 413
4 SASI_Mm02_00424834 predicted 357
5 SASI_Mm02_00424835 predicted 751
6 SASI_Mm02_00424836 predicted 623
7 SASI_Mm01_00238249 predicted 1193
8 SASI_Mm01_00238251 predicted 1185
9 SASI_Mm01_00238252 predicted 974
10 SASI_Mm02_00424837 predicted 428
11 SASI_Mm01_00238248 predicted 1073
12 SASI_Mm01_00238250 predicted 820
13 SASI_Mm01_00238253 predicted 879
14 SASI_Mm01_00238254 predicted 1060
15 SASI_Mm01_00238255 predicted 1206
16 SASI_Mm01_00238256 predicted 985
17 SASI_Mm01_00238257 predicted 1112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152548
FAM81B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 81, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152548.1-1475s1c1
Sequence:CCGGGTTACTATCTCTGGGATGTTTCTCGAGAAACATCCCAGAGATAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152548.1-1471s1c1
Sequence:CCGGGAAAGTTACTATCTCTGGGATCTCGAGATCCCAGAGATAGTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-1114s1c1
Sequence:CCGGGCTTTCAAGCAAAGTAGAGAACTCGAGTTCTCTACTTTGCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-734s1c1
Sequence:CCGGGACATTCACTTATTCAGGCAACTCGAGTTGCCTGAATAAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-326s1c1
Sequence:CCGGGAATATGTTGACAAGAGTCATCTCGAGATGACTCTTGTCAACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-1360s1c1
Sequence:CCGGCCTAAAGAAATTACAGCGCAACTCGAGTTGCGCTGTAATTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-641s1c1
Sequence:CCGGGTACACGAGATAAACATCAAACTCGAGTTTGATGTTTATCTCGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-385s1c1
Sequence:CCGGGCTAGAAGACAGACTGAACAACTCGAGTTGTTCAGTCTGTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-1299s1c1
Sequence:CCGGGCTCCCTCCAACAAATACAGACTCGAGTCTGTATTTGTTGGAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152548
FAM81B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 81, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152548.1-1475s1c1
Sequence:CCGGGTTACTATCTCTGGGATGTTTCTCGAGAAACATCCCAGAGATAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152548.1-1471s1c1
Sequence:CCGGGAAAGTTACTATCTCTGGGATCTCGAGATCCCAGAGATAGTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-1114s1c1
Sequence:CCGGGCTTTCAAGCAAAGTAGAGAACTCGAGTTCTCTACTTTGCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-734s1c1
Sequence:CCGGGACATTCACTTATTCAGGCAACTCGAGTTGCCTGAATAAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-326s1c1
Sequence:CCGGGAATATGTTGACAAGAGTCATCTCGAGATGACTCTTGTCAACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-1360s1c1
Sequence:CCGGCCTAAAGAAATTACAGCGCAACTCGAGTTGCGCTGTAATTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-641s1c1
Sequence:CCGGGTACACGAGATAAACATCAAACTCGAGTTTGATGTTTATCTCGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-385s1c1
Sequence:CCGGGCTAGAAGACAGACTGAACAACTCGAGTTGTTCAGTCTGTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-1299s1c1
Sequence:CCGGGCTCCCTCCAACAAATACAGACTCGAGTCTGTATTTGTTGGAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152548
FAM81B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 81, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152548.1-1475s1c1
Sequence:CCGGGTTACTATCTCTGGGATGTTTCTCGAGAAACATCCCAGAGATAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152548.1-1471s1c1
Sequence:CCGGGAAAGTTACTATCTCTGGGATCTCGAGATCCCAGAGATAGTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-1114s1c1
Sequence:CCGGGCTTTCAAGCAAAGTAGAGAACTCGAGTTCTCTACTTTGCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-734s1c1
Sequence:CCGGGACATTCACTTATTCAGGCAACTCGAGTTGCCTGAATAAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-326s1c1
Sequence:CCGGGAATATGTTGACAAGAGTCATCTCGAGATGACTCTTGTCAACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-1360s1c1
Sequence:CCGGCCTAAAGAAATTACAGCGCAACTCGAGTTGCGCTGTAATTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152548.1-641s1c1
Sequence:CCGGGTACACGAGATAAACATCAAACTCGAGTTTGATGTTTATCTCGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-385s1c1
Sequence:CCGGGCTAGAAGACAGACTGAACAACTCGAGTTGTTCAGTCTGTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152548.1-1299s1c1
Sequence:CCGGGCTCCCTCCAACAAATACAGACTCGAGTCTGTATTTGTTGGAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks