EMAIL THIS PAGE TO A FRIEND

FAM83A

family with sequence similarity 83, member A

72 Gene Product Result for
Synonyms: BJ-TSA-9
UniProtKB ID: Q86UY5, Q71HL2, Q8N7I1, Q96I47
Gene ID:
Mouse(239463) family with sequence similarity 83, member A
Rat(500873) family with sequence similarity 83, member A
chicken(770521) family with sequence similarity 83, member A
domestic cat(101100865) family with sequence similarity 83, member A
cow(521399) family with sequence similarity 83, member A
dog(609275) family with sequence similarity 83, member A
sheep(101108840) family with sequence similarity 83, member A
domestic guinea pig(100726739) family with sequence similarity 83, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059501 MISSION® esiRNA esiRNA human FAM83A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032899 Rosetta Predictions human pricing
NM_207006 Rosetta Predictions human pricing
NM_001130576 Rosetta Predictions rat pricing
NM_173862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208634 predicted 1036
2 SASI_Hs01_00208635 predicted 1008
3 SASI_Hs01_00208636 predicted 751
4 SASI_Hs01_00208637 predicted 1144
5 SASI_Hs01_00208638 predicted 853
6 SASI_Hs01_00208639 predicted 757
7 SASI_Hs01_00208640 predicted 1026
8 SASI_Hs01_00208641 predicted 417
9 SASI_Hs01_00208642 predicted 1140
10 SASI_Hs01_00208643 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143687 predicted 1035
2 SASI_Hs01_00143688 predicted 1004
3 SASI_Hs01_00143689 predicted 751
4 SASI_Hs01_00143690 predicted 1140
5 SASI_Hs01_00143691 predicted 856
6 SASI_Hs01_00143692 predicted 761
7 SASI_Hs01_00143693 predicted 1026
8 SASI_Hs01_00143694 predicted 419
9 SASI_Hs01_00143695 predicted 1144
10 SASI_Hs01_00143696 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255929 predicted 996
2 SASI_Rn02_00255930 predicted 525
3 SASI_Rn02_00255931 predicted 357
4 SASI_Rn02_00255932 predicted 993
5 SASI_Rn02_00255933 predicted 497
6 SASI_Rn02_00255934 predicted 1024
7 SASI_Rn02_00255935 predicted 443
8 SASI_Rn02_00255936 predicted 963
9 SASI_Rn02_00255937 predicted 900
10 SASI_Rn02_00255938 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345441 predicted 831
2 SASI_Mm01_00110538 predicted 276
3 SASI_Mm02_00345442 predicted 992
4 SASI_Mm01_00110542 predicted 785
5 SASI_Mm01_00110545 predicted 670
6 SASI_Mm02_00345443 predicted 854
7 SASI_Mm02_00345444 predicted 1194
8 SASI_Mm02_00345445 predicted 1013
9 SASI_Mm02_00345446 predicted 437
10 SASI_Mm02_00345447 predicted 894
11 SASI_Mm01_00110539 predicted 676
12 SASI_Mm01_00110540 predicted 566
13 SASI_Mm01_00110541 predicted 789
14 SASI_Mm01_00110543 predicted 241
15 SASI_Mm01_00110544 predicted 338
16 SASI_Mm01_00110546 predicted 671
17 SASI_Mm01_00110547 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032899
FAM83A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-1008s1c1
Sequence:CCGGGAGTGTGGAAGGAGAGATATACTCGAGTATATCTCTCCTTCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166857    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032899.4-2554s1c1
Sequence:CCGGCCATCATTCATTTCTTCTCAACTCGAGTTGAGAAGAAATGAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-774s1c1
Sequence:CCGGGCACAACAACATCAGAGACCTCTCGAGAGGTCTCTGATGTTGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032899.4-2327s1c1
Sequence:CCGGGCAGGTTAGTAGACTCAGATTCTCGAGAATCTGAGTCTACTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-975s1c1
Sequence:CCGGCTCTGACAGTCACCTCAAGAACTCGAGTTCTTGAGGTGACTGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-1087s1c1
Sequence:CCGGGACTGGAGATTTGTCCTGTCTCTCGAGAGACAGGACAAATCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032899.4-1045s21c1
Sequence:CCGGAGGAAATTCGCTGGCCAAATCCTCGAGGATTTGGCCAGCGAATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032899.4-2039s21c1
Sequence:CCGGAGATGGTAGTTTGGTACTTCTCTCGAGAGAAGTACCAAACTACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032899
FAM83A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-1008s1c1
Sequence:CCGGGAGTGTGGAAGGAGAGATATACTCGAGTATATCTCTCCTTCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166857    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032899.4-2554s1c1
Sequence:CCGGCCATCATTCATTTCTTCTCAACTCGAGTTGAGAAGAAATGAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-774s1c1
Sequence:CCGGGCACAACAACATCAGAGACCTCTCGAGAGGTCTCTGATGTTGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032899.4-2327s1c1
Sequence:CCGGGCAGGTTAGTAGACTCAGATTCTCGAGAATCTGAGTCTACTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-975s1c1
Sequence:CCGGCTCTGACAGTCACCTCAAGAACTCGAGTTCTTGAGGTGACTGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-1087s1c1
Sequence:CCGGGACTGGAGATTTGTCCTGTCTCTCGAGAGACAGGACAAATCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032899.4-1045s21c1
Sequence:CCGGAGGAAATTCGCTGGCCAAATCCTCGAGGATTTGGCCAGCGAATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032899.4-2039s21c1
Sequence:CCGGAGATGGTAGTTTGGTACTTCTCTCGAGAGAAGTACCAAACTACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032899
FAM83A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-1008s1c1
Sequence:CCGGGAGTGTGGAAGGAGAGATATACTCGAGTATATCTCTCCTTCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166857    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032899.4-2554s1c1
Sequence:CCGGCCATCATTCATTTCTTCTCAACTCGAGTTGAGAAGAAATGAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-774s1c1
Sequence:CCGGGCACAACAACATCAGAGACCTCTCGAGAGGTCTCTGATGTTGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032899.4-2327s1c1
Sequence:CCGGGCAGGTTAGTAGACTCAGATTCTCGAGAATCTGAGTCTACTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-975s1c1
Sequence:CCGGCTCTGACAGTCACCTCAAGAACTCGAGTTCTTGAGGTGACTGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032899.4-1087s1c1
Sequence:CCGGGACTGGAGATTTGTCCTGTCTCTCGAGAGACAGGACAAATCTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032899.4-1045s21c1
Sequence:CCGGAGGAAATTCGCTGGCCAAATCCTCGAGGATTTGGCCAGCGAATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032899.4-2039s21c1
Sequence:CCGGAGATGGTAGTTTGGTACTTCTCTCGAGAGAAGTACCAAACTACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173862
FAM83A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-236s21c1
Sequence:CCGGGAGCTGACTTCAGTGATAATGCTCGAGCATTATCACTGAAGTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-1446s21c1
Sequence:CCGGTCTACAGGCCTTGCCTCATTTCTCGAGAAATGAGGCAAGGCCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-777s21c1
Sequence:CCGGCAAAGTCCAGATCTCTGATATCTCGAGATATCAGAGATCTGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-910s21c1
Sequence:CCGGTTTGTCTTATCCGGATCATACCTCGAGGTATGATCCGGATAAGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173862.2-1577s21c1
Sequence:CCGGCTGGTTCCCTGTGAGCTAATACTCGAGTATTAGCTCACAGGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173862
FAM83A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-236s21c1
Sequence:CCGGGAGCTGACTTCAGTGATAATGCTCGAGCATTATCACTGAAGTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-1446s21c1
Sequence:CCGGTCTACAGGCCTTGCCTCATTTCTCGAGAAATGAGGCAAGGCCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-777s21c1
Sequence:CCGGCAAAGTCCAGATCTCTGATATCTCGAGATATCAGAGATCTGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-910s21c1
Sequence:CCGGTTTGTCTTATCCGGATCATACCTCGAGGTATGATCCGGATAAGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173862.2-1577s21c1
Sequence:CCGGCTGGTTCCCTGTGAGCTAATACTCGAGTATTAGCTCACAGGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173862
FAM83A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-236s21c1
Sequence:CCGGGAGCTGACTTCAGTGATAATGCTCGAGCATTATCACTGAAGTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-1446s21c1
Sequence:CCGGTCTACAGGCCTTGCCTCATTTCTCGAGAAATGAGGCAAGGCCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-777s21c1
Sequence:CCGGCAAAGTCCAGATCTCTGATATCTCGAGATATCAGAGATCTGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173862.2-910s21c1
Sequence:CCGGTTTGTCTTATCCGGATCATACCTCGAGGTATGATCCGGATAAGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173862.2-1577s21c1
Sequence:CCGGCTGGTTCCCTGTGAGCTAATACTCGAGTATTAGCTCACAGGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks