EMAIL THIS PAGE TO A FRIEND

FAM83B

family with sequence similarity 83, member B

56 Gene Product Result for
Synonyms: C6orf143
UniProtKB ID: Q5T0W9, Q2M1P3, Q96DQ2
Gene ID:
Mouse(208994) family with sequence similarity 83, member B
Rat(315829) family with sequence similarity 83, member B
Zebrafish(568458) family with sequence similarity 83, member B
chicken(428645) family with sequence similarity 83, member B
domestic cat(101087994) family with sequence similarity 83, member B
cow(540231) family with sequence similarity 83, member B
dog(481850) family with sequence similarity 83, member B
domestic guinea pig(100730034) family with sequence similarity 83, member B
naked mole-rat(101722542) family with sequence similarity 83, member B
sheep(101108170) family with sequence similarity 83, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010872 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010872 Rosetta Predictions human pricing
NM_001108169 Rosetta Predictions rat pricing
NM_001045518 Rosetta Predictions mouse pricing
XM_146963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046208 predicted 1395
2 SASI_Hs01_00046209 predicted 691
3 SASI_Hs01_00046210 predicted 2603
4 SASI_Hs01_00046211 predicted 1524
5 SASI_Hs01_00046212 predicted 327
6 SASI_Hs01_00046213 predicted 1665
7 SASI_Hs01_00046214 predicted 1334
8 SASI_Hs01_00046215 predicted 433
9 SASI_Hs01_00046217 predicted 1858
10 SASI_Hs02_00305828 predicted 698
11 SASI_Hs01_00046216 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236034 predicted 828
2 SASI_Rn02_00236035 predicted 1530
3 SASI_Rn02_00236036 predicted 868
4 SASI_Rn02_00236037 predicted 846
5 SASI_Rn02_00236038 predicted 469
6 SASI_Rn02_00236039 predicted 549
7 SASI_Rn02_00236040 predicted 1525
8 SASI_Rn02_00236041 predicted 2424
9 SASI_Rn02_00236042 predicted 717
10 SASI_Rn02_00236043 predicted 2227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291544 predicted 2719
2 SASI_Mm02_00291545 predicted 429
3 SASI_Mm02_00291546 predicted 1040
4 SASI_Mm02_00291547 predicted 1436
5 SASI_Mm02_00291548 predicted 1574
6 SASI_Mm02_00291549 predicted 345
7 SASI_Mm02_00291550 predicted 775
8 SASI_Mm02_00291551 predicted 2269
9 SASI_Mm02_00291552 predicted 2339
10 SASI_Mm02_00291553 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238691 predicted 822
2 SASI_Mm01_00238692 predicted 522
3 SASI_Mm01_00238693 predicted 1137
4 SASI_Mm01_00238694 predicted 558
5 SASI_Mm01_00238695 predicted 1323
6 SASI_Mm01_00238696 predicted 440
7 SASI_Mm01_00238697 predicted 869
8 SASI_Mm01_00238698 predicted 199
9 SASI_Mm01_00238699 predicted 556
10 SASI_Mm01_00238700 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045518
FAM83B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-2026s21c1
Sequence:CCGGGACCACTCGAAGGTCAATTTACTCGAGTAAATTGACCTTCGAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-2513s21c1
Sequence:CCGGAGCGTTCCTCCTCGTCAAATTCTCGAGAATTTGACGAGGAGGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-457s21c1
Sequence:CCGGGCGAGAAAGGTGGTTGCTATACTCGAGTATAGCAACCACCTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-1422s21c1
Sequence:CCGGTAACGGGACAGATAATCATATCTCGAGATATGATTATCTGTCCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-633s21c1
Sequence:CCGGCATTCGCATACGGACAGTAAACTCGAGTTTACTGTCCGTATGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045518
FAM83B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-2026s21c1
Sequence:CCGGGACCACTCGAAGGTCAATTTACTCGAGTAAATTGACCTTCGAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-2513s21c1
Sequence:CCGGAGCGTTCCTCCTCGTCAAATTCTCGAGAATTTGACGAGGAGGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-457s21c1
Sequence:CCGGGCGAGAAAGGTGGTTGCTATACTCGAGTATAGCAACCACCTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-1422s21c1
Sequence:CCGGTAACGGGACAGATAATCATATCTCGAGATATGATTATCTGTCCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-633s21c1
Sequence:CCGGCATTCGCATACGGACAGTAAACTCGAGTTTACTGTCCGTATGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045518
FAM83B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-2026s21c1
Sequence:CCGGGACCACTCGAAGGTCAATTTACTCGAGTAAATTGACCTTCGAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-2513s21c1
Sequence:CCGGAGCGTTCCTCCTCGTCAAATTCTCGAGAATTTGACGAGGAGGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-457s21c1
Sequence:CCGGGCGAGAAAGGTGGTTGCTATACTCGAGTATAGCAACCACCTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-1422s21c1
Sequence:CCGGTAACGGGACAGATAATCATATCTCGAGATATGATTATCTGTCCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045518.1-633s21c1
Sequence:CCGGCATTCGCATACGGACAGTAAACTCGAGTTTACTGTCCGTATGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010872
FAM83B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-1733s1c1
Sequence:CCGGGCTTCGTTCCTCTTTAGTATTCTCGAGAATACTAAAGAGGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-357s1c1
Sequence:CCGGGATTCCTGTGATGATACCTTACTCGAGTAAGGTATCATCACAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-361s1c1
Sequence:CCGGCCTGTGATGATACCTTATCTTCTCGAGAAGATAAGGTATCATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-827s1c1
Sequence:CCGGGAAAGTGATGTACGGTTCTTACTCGAGTAAGAACCGTACATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-469s1c1
Sequence:CCGGGCACCCATATAGATCTCCTTTCTCGAGAAAGGAGATCTATATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-1221s1c1
Sequence:CCGGCCAAACGCAATACGTCAGTTTCTCGAGAAACTGACGTATTGCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-2337s1c1
Sequence:CCGGGCTGCTTTACTTGATGTGAATCTCGAGATTCACATCAAGTAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-180s1c1
Sequence:CCGGCCTCACTACAAGGAATGGTATCTCGAGATACCATTCCTTGTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-2429s1c1
Sequence:CCGGGTCTCAGAAGTTAAGGTCATTCTCGAGAATGACCTTAACTTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010872
FAM83B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-1733s1c1
Sequence:CCGGGCTTCGTTCCTCTTTAGTATTCTCGAGAATACTAAAGAGGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-357s1c1
Sequence:CCGGGATTCCTGTGATGATACCTTACTCGAGTAAGGTATCATCACAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-361s1c1
Sequence:CCGGCCTGTGATGATACCTTATCTTCTCGAGAAGATAAGGTATCATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-827s1c1
Sequence:CCGGGAAAGTGATGTACGGTTCTTACTCGAGTAAGAACCGTACATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-469s1c1
Sequence:CCGGGCACCCATATAGATCTCCTTTCTCGAGAAAGGAGATCTATATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-1221s1c1
Sequence:CCGGCCAAACGCAATACGTCAGTTTCTCGAGAAACTGACGTATTGCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-2337s1c1
Sequence:CCGGGCTGCTTTACTTGATGTGAATCTCGAGATTCACATCAAGTAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-180s1c1
Sequence:CCGGCCTCACTACAAGGAATGGTATCTCGAGATACCATTCCTTGTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-2429s1c1
Sequence:CCGGGTCTCAGAAGTTAAGGTCATTCTCGAGAATGACCTTAACTTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010872
FAM83B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-1733s1c1
Sequence:CCGGGCTTCGTTCCTCTTTAGTATTCTCGAGAATACTAAAGAGGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-357s1c1
Sequence:CCGGGATTCCTGTGATGATACCTTACTCGAGTAAGGTATCATCACAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-361s1c1
Sequence:CCGGCCTGTGATGATACCTTATCTTCTCGAGAAGATAAGGTATCATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-827s1c1
Sequence:CCGGGAAAGTGATGTACGGTTCTTACTCGAGTAAGAACCGTACATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-469s1c1
Sequence:CCGGGCACCCATATAGATCTCCTTTCTCGAGAAAGGAGATCTATATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-1221s1c1
Sequence:CCGGCCAAACGCAATACGTCAGTTTCTCGAGAAACTGACGTATTGCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010872.1-2337s1c1
Sequence:CCGGGCTGCTTTACTTGATGTGAATCTCGAGATTCACATCAAGTAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-180s1c1
Sequence:CCGGCCTCACTACAAGGAATGGTATCTCGAGATACCATTCCTTGTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010872.1-2429s1c1
Sequence:CCGGGTCTCAGAAGTTAAGGTCATTCTCGAGAATGACCTTAACTTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks