EMAIL THIS PAGE TO A FRIEND

FAM83C

family with sequence similarity 83, member C

53 Gene Product Result for
Synonyms: C20orf128 dJ614O4.7
UniProtKB ID: Q9BQN1, Q14D67, Q5JWN6, Q8N276
Gene ID:
Mouse(71405) family with sequence similarity 83, member C
Rat(683506) family with sequence similarity 83, member C
sheep(101119841) family with sequence similarity 83, member C
Domestic Rabbit(100328918) family with sequence similarity 83, member C
naked mole-rat(101702527) family with sequence similarity 83, member C
domestic guinea pig(100720607) family with sequence similarity 83, member C
Zebrafish(503970) family with sequence similarity 83, member C
chicken(769474) family with sequence similarity 83, member C
domestic cat(101082393) family with sequence similarity 83, member C
cow(101903690) family with sequence similarity 83, member C
dog(610119) family with sequence similarity 83, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178468 Rosetta Predictions human pricing
XM_001066240 Rosetta Predictions rat pricing
NM_027788 Rosetta Predictions mouse pricing
XM_141565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050490 predicted 2125
2 SASI_Hs01_00050491 predicted 2224
3 SASI_Hs01_00050492 predicted 281
4 SASI_Hs01_00050493 predicted 1172
5 SASI_Hs01_00050494 predicted 1665
6 SASI_Hs01_00050495 predicted 1174
7 SASI_Hs01_00050496 predicted 2059
8 SASI_Hs02_00369720 predicted 659
9 SASI_Hs01_00050498 predicted 899
10 SASI_Hs01_00050499 predicted 1883
11 SASI_Hs01_00050497 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316763 predicted 1045
2 SASI_Rn02_00316764 predicted 1579
3 SASI_Rn02_00316765 predicted 1704
4 SASI_Rn02_00316766 predicted 955
5 SASI_Rn02_00316767 predicted 518
6 SASI_Rn02_00316768 predicted 1302
7 SASI_Rn02_00316769 predicted 1735
8 SASI_Rn02_00316770 predicted 1723
9 SASI_Rn02_00316771 predicted 725
10 SASI_Rn02_00316772 predicted 1980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332730 predicted 1826
2 SASI_Mm02_00332731 predicted 1078
3 SASI_Mm02_00332732 predicted 1718
4 SASI_Mm02_00332733 predicted 1701
5 SASI_Mm02_00332734 predicted 950
6 SASI_Mm02_00332735 predicted 1272
7 SASI_Mm02_00332736 predicted 1316
8 SASI_Mm02_00332737 predicted 1888
9 SASI_Mm02_00332738 predicted 888
10 SASI_Mm02_00332739 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276731 predicted 1090
2 SASI_Mm01_00276732 predicted 1719
3 SASI_Mm01_00276733 predicted 1708
4 SASI_Mm01_00276734 predicted 957
5 SASI_Mm01_00276735 predicted 1274
6 SASI_Mm01_00276736 predicted 902
7 SASI_Mm01_00276737 predicted 2269
8 SASI_Mm01_00276738 predicted 733
9 SASI_Mm01_00276739 predicted 1953
10 SASI_Mm01_00276740 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178468
FAM83C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-636s1c1
Sequence:CCGGCCTGGAGATGTGCTACAAGATCTCGAGATCTTGTAGCACATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-1902s1c1
Sequence:CCGGGCTGGACCTCATCACAAAGTTCTCGAGAACTTTGTGATGAGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-642s1c1
Sequence:CCGGGATGTGCTACAAGATGGACCTCTCGAGAGGTCCATCTTGTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-528s1c1
Sequence:CCGGGATGGACATATTCACTGACATCTCGAGATGTCAGTGAATATGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-2038s1c1
Sequence:CCGGCTGGACCTCATCACCAAGTATCTCGAGATACTTGGTGATGAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178468
FAM83C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-636s1c1
Sequence:CCGGCCTGGAGATGTGCTACAAGATCTCGAGATCTTGTAGCACATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-1902s1c1
Sequence:CCGGGCTGGACCTCATCACAAAGTTCTCGAGAACTTTGTGATGAGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-642s1c1
Sequence:CCGGGATGTGCTACAAGATGGACCTCTCGAGAGGTCCATCTTGTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-528s1c1
Sequence:CCGGGATGGACATATTCACTGACATCTCGAGATGTCAGTGAATATGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-2038s1c1
Sequence:CCGGCTGGACCTCATCACCAAGTATCTCGAGATACTTGGTGATGAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178468
FAM83C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-636s1c1
Sequence:CCGGCCTGGAGATGTGCTACAAGATCTCGAGATCTTGTAGCACATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-1902s1c1
Sequence:CCGGGCTGGACCTCATCACAAAGTTCTCGAGAACTTTGTGATGAGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-642s1c1
Sequence:CCGGGATGTGCTACAAGATGGACCTCTCGAGAGGTCCATCTTGTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-528s1c1
Sequence:CCGGGATGGACATATTCACTGACATCTCGAGATGTCAGTGAATATGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178468.1-2038s1c1
Sequence:CCGGCTGGACCTCATCACCAAGTATCTCGAGATACTTGGTGATGAGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027788
FAM83C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1274s21c1
Sequence:CCGGATCCCTGTATCGTCAACTTTCCTCGAGGAAAGTTGACGATACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-729s21c1
Sequence:CCGGTACTTCCTGGAGATGTGTTATCTCGAGATAACACATCTCCAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1903s21c1
Sequence:CCGGAGATGCCCTCCGATGCCTATTCTCGAGAATAGGCATCGGAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-527s21c1
Sequence:CCGGCACTCAGGCGGTGGTTCATTTCTCGAGAAATGAACCACCGCCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1987s21c1
Sequence:CCGGTGGACCTCATTACCAAGTTTGCTCGAGCAAACTTGGTAATGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027788
FAM83C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1274s21c1
Sequence:CCGGATCCCTGTATCGTCAACTTTCCTCGAGGAAAGTTGACGATACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-729s21c1
Sequence:CCGGTACTTCCTGGAGATGTGTTATCTCGAGATAACACATCTCCAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1903s21c1
Sequence:CCGGAGATGCCCTCCGATGCCTATTCTCGAGAATAGGCATCGGAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-527s21c1
Sequence:CCGGCACTCAGGCGGTGGTTCATTTCTCGAGAAATGAACCACCGCCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1987s21c1
Sequence:CCGGTGGACCTCATTACCAAGTTTGCTCGAGCAAACTTGGTAATGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027788
FAM83C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1274s21c1
Sequence:CCGGATCCCTGTATCGTCAACTTTCCTCGAGGAAAGTTGACGATACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-729s21c1
Sequence:CCGGTACTTCCTGGAGATGTGTTATCTCGAGATAACACATCTCCAGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1903s21c1
Sequence:CCGGAGATGCCCTCCGATGCCTATTCTCGAGAATAGGCATCGGAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-527s21c1
Sequence:CCGGCACTCAGGCGGTGGTTCATTTCTCGAGAAATGAACCACCGCCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027788.1-1987s21c1
Sequence:CCGGTGGACCTCATTACCAAGTTTGCTCGAGCAAACTTGGTAATGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks