EMAIL THIS PAGE TO A FRIEND

FAM83D

family with sequence similarity 83, member D

81 Gene Product Result for
Synonyms: C20orf129 CHICA dJ616B8.3
Gene ID:
Mouse(71878) family with sequence similarity 83, member D
Rat(311598) family with sequence similarity 83, member D
Zebrafish(492689) family with sequence similarity 83, member D
cow(508561) family with sequence similarity 83, member D
domestic cat(101093676) family with sequence similarity 83, member D
dog(100683673) family with sequence similarity 83, member D
chicken(419171) family with sequence similarity 83, member D
chicken(425103) family with sequence similarity 83, member D
domestic guinea pig(100732929) family with sequence similarity 83, member D
naked mole-rat(101723346) family with sequence similarity 83, member D
sheep(101102582) family with sequence similarity 83, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030919 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030919 Rosetta Predictions human pricing
NM_001107796 Rosetta Predictions rat pricing
NM_027975 Rosetta Predictions mouse pricing
XM_130601 Rosetta Predictions mouse pricing
XM_902804 Rosetta Predictions mouse pricing
XM_902808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358466 predicted 1720
2 SASI_Hs01_00209821 predicted 829
3 SASI_Hs02_00358467 predicted 1735
4 SASI_Hs01_00209826 predicted 787
5 SASI_Hs02_00358468 predicted 801
6 SASI_Hs02_00358469 predicted 1767
7 SASI_Hs02_00358470 predicted 1779
8 SASI_Hs02_00358471 predicted 681
9 SASI_Hs01_00209829 predicted 738
10 SASI_Hs02_00358472 predicted 1698
11 SASI_Hs01_00209820 predicted 755
12 SASI_Hs01_00209822 predicted 692
13 SASI_Hs01_00209823 predicted 1218
14 SASI_Hs01_00209824 predicted 1135
15 SASI_Hs01_00209825 predicted 887
16 SASI_Hs01_00209827 predicted 1389
17 SASI_Hs01_00209828 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232355 predicted 1201
2 SASI_Rn02_00232356 predicted 799
3 SASI_Rn02_00232357 predicted 715
4 SASI_Rn02_00232358 predicted 812
5 SASI_Rn02_00232359 predicted 1762
6 SASI_Rn02_00232360 predicted 1868
7 SASI_Rn02_00232361 predicted 619
8 SASI_Rn02_00232362 predicted 940
9 SASI_Rn02_00232363 predicted 657
10 SASI_Rn02_00232364 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333012 predicted 648
2 SASI_Mm02_00333013 predicted 628
3 SASI_Mm02_00333014 predicted 809
4 SASI_Mm02_00333015 predicted 1746
5 SASI_Mm02_00333016 predicted 699
6 SASI_Mm02_00333017 predicted 1591
7 SASI_Mm02_00333018 predicted 687
8 SASI_Mm02_00333019 predicted 664
9 SASI_Mm02_00333020 predicted 1094
10 SASI_Mm02_00333021 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247358 predicted 1657
2 SASI_Mm01_00247359 predicted 1793
3 SASI_Mm01_00247360 predicted 1606
4 SASI_Mm01_00247361 predicted 1632
5 SASI_Mm01_00247362 predicted 1975
6 SASI_Mm01_00247363 predicted 1963
7 SASI_Mm01_00247364 predicted 1149
8 SASI_Mm01_00247365 predicted 1888
9 SASI_Mm01_00247366 predicted 1914
10 SASI_Mm01_00247367 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258895 predicted 2691
2 SASI_Mm01_00258896 predicted 2821
3 SASI_Mm01_00258897 predicted 2634
4 SASI_Mm01_00258898 predicted 2661
5 SASI_Mm01_00258899 predicted 2995
6 SASI_Mm01_00258900 predicted 2996
7 SASI_Mm01_00258901 predicted 2173
8 SASI_Mm01_00258902 predicted 2922
9 SASI_Mm01_00258903 predicted 2941
10 SASI_Mm01_00258904 predicted 2732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250851 predicted 928
2 SASI_Mm01_00250852 predicted 1061
3 SASI_Mm01_00250853 predicted 877
4 SASI_Mm01_00250854 predicted 899
5 SASI_Mm01_00250855 predicted 1246
6 SASI_Mm01_00250856 predicted 1239
7 SASI_Mm01_00250857 predicted 422
8 SASI_Mm01_00250858 predicted 1165
9 SASI_Mm01_00250859 predicted 1178
10 SASI_Mm01_00250860 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030919
VALIDATED
FAM83D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member D
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1825s21c1
Sequence:CCGGGCAATTTCAGCAGAGTTAATTCTCGAGAATTAACTCTGCTGAAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030919.2-2182s21c1
Sequence:CCGGGTTGGCAGTCTCATAAGATTACTCGAGTAATCTTATGAGACTGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1870s21c1
Sequence:CCGGTTTATCCTTCCTATCAGTAACCTCGAGGTTACTGATAGGAAGGATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030919.2-2058s21c1
Sequence:CCGGGTCATGTATATACCAGGTATTCTCGAGAATACCTGGTATATACATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1417s21c1
Sequence:CCGGCAAGCTCTCAAACCACGATTTCTCGAGAAATCGTGGTTTGAGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1709s21c1
Sequence:CCGGCTTGAACAAAGAGCGGCAATTCTCGAGAATTGCCGCTCTTTGTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-792s1c1
Sequence:CCGGCAGTTCGGACTATCACAGGAACTCGAGTTCCTGTGATAGTCCGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-1993s1c1
Sequence:CCGGCCTGACTTTGTCACCTTTGTTCTCGAGAACAAAGGTGACAAAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-755s1c1
Sequence:CCGGGATCTGAAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTTCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-743s1c1
Sequence:CCGGGATATGTGCATGGATCTGAAACTCGAGTTTCAGATCCATGCACATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-865s1c1
Sequence:CCGGGTTCACGTTGATTGATGGCATCTCGAGATGCCATCAATCAACGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-653s1c1
Sequence:CCGGGACATCTTCAGAGACCTGCAACTCGAGTTGCAGGTCTCTGAAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030919
VALIDATED
FAM83D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member D
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1825s21c1
Sequence:CCGGGCAATTTCAGCAGAGTTAATTCTCGAGAATTAACTCTGCTGAAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030919.2-2182s21c1
Sequence:CCGGGTTGGCAGTCTCATAAGATTACTCGAGTAATCTTATGAGACTGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1870s21c1
Sequence:CCGGTTTATCCTTCCTATCAGTAACCTCGAGGTTACTGATAGGAAGGATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030919.2-2058s21c1
Sequence:CCGGGTCATGTATATACCAGGTATTCTCGAGAATACCTGGTATATACATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1417s21c1
Sequence:CCGGCAAGCTCTCAAACCACGATTTCTCGAGAAATCGTGGTTTGAGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1709s21c1
Sequence:CCGGCTTGAACAAAGAGCGGCAATTCTCGAGAATTGCCGCTCTTTGTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-792s1c1
Sequence:CCGGCAGTTCGGACTATCACAGGAACTCGAGTTCCTGTGATAGTCCGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-1993s1c1
Sequence:CCGGCCTGACTTTGTCACCTTTGTTCTCGAGAACAAAGGTGACAAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-755s1c1
Sequence:CCGGGATCTGAAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTTCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-743s1c1
Sequence:CCGGGATATGTGCATGGATCTGAAACTCGAGTTTCAGATCCATGCACATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-865s1c1
Sequence:CCGGGTTCACGTTGATTGATGGCATCTCGAGATGCCATCAATCAACGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-653s1c1
Sequence:CCGGGACATCTTCAGAGACCTGCAACTCGAGTTGCAGGTCTCTGAAGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030919
VALIDATED
FAM83D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member D
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1825s21c1
Sequence:CCGGGCAATTTCAGCAGAGTTAATTCTCGAGAATTAACTCTGCTGAAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030919.2-2182s21c1
Sequence:CCGGGTTGGCAGTCTCATAAGATTACTCGAGTAATCTTATGAGACTGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1870s21c1
Sequence:CCGGTTTATCCTTCCTATCAGTAACCTCGAGGTTACTGATAGGAAGGATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030919.2-2058s21c1
Sequence:CCGGGTCATGTATATACCAGGTATTCTCGAGAATACCTGGTATATACATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1417s21c1
Sequence:CCGGCAAGCTCTCAAACCACGATTTCTCGAGAAATCGTGGTTTGAGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030919.2-1709s21c1
Sequence:CCGGCTTGAACAAAGAGCGGCAATTCTCGAGAATTGCCGCTCTTTGTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-792s1c1
Sequence:CCGGCAGTTCGGACTATCACAGGAACTCGAGTTCCTGTGATAGTCCGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-1993s1c1
Sequence:CCGGCCTGACTTTGTCACCTTTGTTCTCGAGAACAAAGGTGACAAAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030919.1-755s1c1
Sequence:CCGGGATCTGAAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTTCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-743s1c1
Sequence:CCGGGATATGTGCATGGATCTGAAACTCGAGTTTCAGATCCATGCACATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-865s1c1
Sequence:CCGGGTTCACGTTGATTGATGGCATCTCGAGATGCCATCAATCAACGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030919.1-653s1c1
Sequence:CCGGGACATCTTCAGAGACCTGCAACTCGAGTTGCAGGTCTCTGAAGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027975
VALIDATED
FAM83D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member D
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-658s21c1
Sequence:CCGGCTGATGACAGTTCGGACAATTCTCGAGAATTGTCCGAACTGTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-911s21c1
Sequence:CCGGTGTCCAACTTCCAGATCAATACTCGAGTATTGATCTGGAAGTTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-2000s21c1
Sequence:CCGGGGTTGGTTTGAGAGATAAATACTCGAGTATTTATCTCTCAAACCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-1108s21c1
Sequence:CCGGATCAGCGATGAAGACTATTTCCTCGAGGAAATAGTCTTCATCGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027975
VALIDATED
FAM83D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member D
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-658s21c1
Sequence:CCGGCTGATGACAGTTCGGACAATTCTCGAGAATTGTCCGAACTGTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-911s21c1
Sequence:CCGGTGTCCAACTTCCAGATCAATACTCGAGTATTGATCTGGAAGTTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-2000s21c1
Sequence:CCGGGGTTGGTTTGAGAGATAAATACTCGAGTATTTATCTCTCAAACCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-1108s21c1
Sequence:CCGGATCAGCGATGAAGACTATTTCCTCGAGGAAATAGTCTTCATCGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027975
VALIDATED
FAM83D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member D
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-658s21c1
Sequence:CCGGCTGATGACAGTTCGGACAATTCTCGAGAATTGTCCGAACTGTCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-911s21c1
Sequence:CCGGTGTCCAACTTCCAGATCAATACTCGAGTATTGATCTGGAAGTTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-2000s21c1
Sequence:CCGGGGTTGGTTTGAGAGATAAATACTCGAGTATTTATCTCTCAAACCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027975.2-1108s21c1
Sequence:CCGGATCAGCGATGAAGACTATTTCCTCGAGGAAATAGTCTTCATCGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)