EMAIL THIS PAGE TO A FRIEND

FAM83E

family with sequence similarity 83, member E

62 Gene Product Result for
UniProtKB ID: Q2M2I3, Q9NXK1
Gene ID:
Mouse(73813) family with sequence similarity 83, member E
Rat(292913) family with sequence similarity 83, member E
sheep(101106710) family with sequence similarity 83, member E
naked mole-rat(101723573) family with sequence similarity 83, member E
domestic guinea pig(100732738) family with sequence similarity 83, member E
dog(612040) family with sequence similarity 83, member E
cow(100851343) family with sequence similarity 83, member E
domestic cat(101086614) family with sequence similarity 83, member E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186141 MISSION® esiRNA esiRNA targeting mouse Fam83e mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017708 Rosetta Predictions human pricing
XM_001079852 Rosetta Predictions rat pricing
XM_218559 Rosetta Predictions rat pricing
NM_001033170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134729 predicted 601
2 SASI_Hs01_00134730 predicted 896
3 SASI_Hs01_00134731 predicted 1415
4 SASI_Hs01_00134733 predicted 890
5 SASI_Hs02_00350469 predicted 516
6 SASI_Hs01_00134734 predicted 865
7 SASI_Hs01_00134735 predicted 696
8 SASI_Hs01_00134736 predicted 409
9 SASI_Hs01_00134738 predicted 871
10 SASI_Hs02_00350470 predicted 262
11 SASI_Hs01_00134732 predicted 933
12 SASI_Hs01_00134737 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365728 predicted 836
2 SASI_Rn02_00365729 predicted 1542
3 SASI_Rn02_00365730 predicted 1544
4 SASI_Rn02_00365731 predicted 547
5 SASI_Rn02_00365732 predicted 556
6 SASI_Rn02_00365733 predicted 476
7 SASI_Rn02_00365734 predicted 886
8 SASI_Rn02_00365735 predicted 1535
9 SASI_Rn02_00365736 predicted 1263
10 SASI_Rn02_00365737 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377851 predicted 232
2 SASI_Rn02_00377852 predicted 1080
3 SASI_Rn02_00377853 predicted 1009
4 SASI_Rn02_00377854 predicted 1141
5 SASI_Rn02_00377855 predicted 240
6 SASI_Rn02_00377856 predicted 1019
7 SASI_Rn02_00377857 predicted 1076
8 SASI_Rn02_00377858 predicted 1160
9 SASI_Rn02_00377859 predicted 1138
10 SASI_Rn02_00377860 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021112 predicted 1384
2 SASI_Mm02_00288262 predicted 2045
3 SASI_Mm01_00021113 predicted 1317
4 SASI_Mm01_00021114 predicted 1467
5 SASI_Mm02_00288263 predicted 1847
6 SASI_Mm01_00021115 predicted 1079
7 SASI_Mm01_00021116 predicted 1259
8 SASI_Mm02_00288264 predicted 1766
9 SASI_Mm02_00288265 predicted 2506
10 SASI_Mm01_00021120 predicted 1668
11 SASI_Mm01_00021117 predicted 2009
12 SASI_Mm01_00021118 predicted 1977
13 SASI_Mm01_00021119 predicted 2082
14 SASI_Mm01_00021121 predicted 1922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017708
FAM83E MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member E
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017708.1-1241s1c1
Sequence:CCGGCAGTGACATTCTAAGGAGTGTCTCGAGACACTCCTTAGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017708.3-1619s21c1
Sequence:CCGGGTCAAGCAGAAGGGATGTTTGCTCGAGCAAACATCCCTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-1231s21c1
Sequence:CCGGGGGACAACGAGCTCAAGAAATCTCGAGATTTCTTGAGCTCGTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-1109s21c1
Sequence:CCGGGGCACTCAGTGACATTCTAAGCTCGAGCTTAGAATGTCACTGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-863s21c1
Sequence:CCGGGACCCTGCTGACTGGTGAAATCTCGAGATTTCACCAGTCAGCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-689s21c1
Sequence:CCGGGAACACGGAGAACGTGGATGTCTCGAGACATCCACGTTCTCCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017708
FAM83E MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member E
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017708.1-1241s1c1
Sequence:CCGGCAGTGACATTCTAAGGAGTGTCTCGAGACACTCCTTAGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017708.3-1619s21c1
Sequence:CCGGGTCAAGCAGAAGGGATGTTTGCTCGAGCAAACATCCCTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-1231s21c1
Sequence:CCGGGGGACAACGAGCTCAAGAAATCTCGAGATTTCTTGAGCTCGTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-1109s21c1
Sequence:CCGGGGCACTCAGTGACATTCTAAGCTCGAGCTTAGAATGTCACTGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-863s21c1
Sequence:CCGGGACCCTGCTGACTGGTGAAATCTCGAGATTTCACCAGTCAGCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-689s21c1
Sequence:CCGGGAACACGGAGAACGTGGATGTCTCGAGACATCCACGTTCTCCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017708
FAM83E MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member E
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017708.1-1241s1c1
Sequence:CCGGCAGTGACATTCTAAGGAGTGTCTCGAGACACTCCTTAGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017708.3-1619s21c1
Sequence:CCGGGTCAAGCAGAAGGGATGTTTGCTCGAGCAAACATCCCTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-1231s21c1
Sequence:CCGGGGGACAACGAGCTCAAGAAATCTCGAGATTTCTTGAGCTCGTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-1109s21c1
Sequence:CCGGGGCACTCAGTGACATTCTAAGCTCGAGCTTAGAATGTCACTGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-863s21c1
Sequence:CCGGGACCCTGCTGACTGGTGAAATCTCGAGATTTCACCAGTCAGCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017708.3-689s21c1
Sequence:CCGGGAACACGGAGAACGTGGATGTCTCGAGACATCCACGTTCTCCGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033170
FAM83E MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1379s21c1
Sequence:CCGGGAGGGCCAACCACCCATTAAACTCGAGTTTAATGGGTGGTTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1594s21c1
Sequence:CCGGGACCACTGAGAACCTGGATATCTCGAGATATCCAGGTTCTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1180s21c1
Sequence:CCGGTGCTGAAGACTGGCTAGTACCCTCGAGGGTACTAGCCAGTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1952s21c1
Sequence:CCGGTTGCTGTCTGATGGGCCTTTGCTCGAGCAAAGGCCCATCAGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033170.4-2634s21c1
Sequence:CCGGTGCCTCACCATGTACTATATACTCGAGTATATAGTACATGGTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033170
FAM83E MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1379s21c1
Sequence:CCGGGAGGGCCAACCACCCATTAAACTCGAGTTTAATGGGTGGTTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1594s21c1
Sequence:CCGGGACCACTGAGAACCTGGATATCTCGAGATATCCAGGTTCTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1180s21c1
Sequence:CCGGTGCTGAAGACTGGCTAGTACCCTCGAGGGTACTAGCCAGTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1952s21c1
Sequence:CCGGTTGCTGTCTGATGGGCCTTTGCTCGAGCAAAGGCCCATCAGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033170.4-2634s21c1
Sequence:CCGGTGCCTCACCATGTACTATATACTCGAGTATATAGTACATGGTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033170
FAM83E MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1379s21c1
Sequence:CCGGGAGGGCCAACCACCCATTAAACTCGAGTTTAATGGGTGGTTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1594s21c1
Sequence:CCGGGACCACTGAGAACCTGGATATCTCGAGATATCCAGGTTCTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1180s21c1
Sequence:CCGGTGCTGAAGACTGGCTAGTACCCTCGAGGGTACTAGCCAGTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033170.4-1952s21c1
Sequence:CCGGTTGCTGTCTGATGGGCCTTTGCTCGAGCAAAGGCCCATCAGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033170.4-2634s21c1
Sequence:CCGGTGCCTCACCATGTACTATATACTCGAGTATATAGTACATGGTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks