EMAIL THIS PAGE TO A FRIEND

FAM83F

family with sequence similarity 83, member F

106 Gene Product Result for
UniProtKB ID: Q8NEG4, Q96FD6
Gene ID:
Mouse(213956) family with sequence similarity 83, member F
Rat(315145) family with sequence similarity 83, member F
chicken(770747) family with sequence similarity 83, member F
dog(474500) family with sequence similarity 83, member F
cow(538476) family with sequence similarity 83, member F
domestic cat(101098064) family with sequence similarity 83, member F
domestic guinea pig(100733418) family with sequence similarity 83, member F
naked mole-rat(101721455) family with sequence similarity 83, member F
sheep(101102139) family with sequence similarity 83, member F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152731 MISSION® esiRNA esiRNA human FAM83F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138435 Rosetta Predictions human pricing
NM_001130502 Rosetta Predictions rat pricing
NM_145986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094029 predicted 816
2 SASI_Hs01_00094030 predicted 1558
3 SASI_Hs01_00094031 predicted 610
4 SASI_Hs01_00094032 predicted 1348
5 SASI_Hs01_00094033 predicted 658
6 SASI_Hs01_00094034 predicted 1569
7 SASI_Hs01_00094035 predicted 763
8 SASI_Hs01_00094036 predicted 1663
9 SASI_Hs01_00094037 predicted 1480
10 SASI_Hs01_00094038 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255449 predicted 1701
2 SASI_Rn02_00255450 predicted 1209
3 SASI_Rn02_00255451 predicted 1485
4 SASI_Rn02_00255452 predicted 1710
5 SASI_Rn02_00255453 predicted 967
6 SASI_Rn02_00255454 predicted 1536
7 SASI_Rn02_00255455 predicted 822
8 SASI_Rn02_00255456 predicted 781
9 SASI_Rn02_00255457 predicted 670
10 SASI_Rn02_00255458 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155428 predicted 1504
2 SASI_Mm02_00341499 predicted 590
3 SASI_Mm01_00155429 predicted 1720
4 SASI_Mm01_00155430 predicted 691
5 SASI_Mm01_00155432 predicted 1174
6 SASI_Mm01_00155434 predicted 838
7 SASI_Mm01_00155435 predicted 1784
8 SASI_Mm01_00155436 predicted 802
9 SASI_Mm02_00341500 predicted 856
10 SASI_Mm02_00341501 predicted 1519
11 SASI_Mm01_00155427 predicted 1673
12 SASI_Mm01_00155431 predicted 2019
13 SASI_Mm01_00155433 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138435
FAM83F MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member F
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-552s21c1
Sequence:CCGGTGGTCAGGCAGATGATCCAACCTCGAGGTTGGATCATCTGCCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138435.2-1667s21c1
Sequence:CCGGGTCGCACACTGCACCAGTTTGCTCGAGCAAACTGGTGCAGTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-834s21c1
Sequence:CCGGTGATGGTGGACGGTGACAAAGCTCGAGCTTTGTCACCGTCCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-729s21c1
Sequence:CCGGAGCTCACTGACTTCCGGATTCCTCGAGGAATCCGGAAGTCAGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-539s1c1
Sequence:CCGGCGAGGCAGGAGTGAAGTATTTCTCGAGAAATACTTCACTCCTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-488s1c1
Sequence:CCGGCATTGTGGATGCTGCCTGTAACTCGAGTTACAGGCAGCATCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138435.1-1773s1c1
Sequence:CCGGGCCCATTCTTTAAACCTTTATCTCGAGATAAAGGTTTAAAGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138435.1-1684s1c1
Sequence:CCGGGCCTCCTTGTTTACATGAAGTCTCGAGACTTCATGTAAACAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-712s1c1
Sequence:CCGGCCACTGGATCTTACAGGTTCACTCGAGTGAACCTGTAAGATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-674s1c1
Sequence:CCGGGTCATCAAGGTTCCTGATGGTCTCGAGACCATCAGGAACCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-1427s1c1
Sequence:CCGGGCCTAGCAACTGTGTGATTTCCTCGAGGAAATCACACAGTTGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-671s1c1
Sequence:CCGGCCTGTCATCAAGGTTCCTGATCTCGAGATCAGGAACCTTGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138435
FAM83F MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member F
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-552s21c1
Sequence:CCGGTGGTCAGGCAGATGATCCAACCTCGAGGTTGGATCATCTGCCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138435.2-1667s21c1
Sequence:CCGGGTCGCACACTGCACCAGTTTGCTCGAGCAAACTGGTGCAGTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-834s21c1
Sequence:CCGGTGATGGTGGACGGTGACAAAGCTCGAGCTTTGTCACCGTCCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-729s21c1
Sequence:CCGGAGCTCACTGACTTCCGGATTCCTCGAGGAATCCGGAAGTCAGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-539s1c1
Sequence:CCGGCGAGGCAGGAGTGAAGTATTTCTCGAGAAATACTTCACTCCTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-488s1c1
Sequence:CCGGCATTGTGGATGCTGCCTGTAACTCGAGTTACAGGCAGCATCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138435.1-1773s1c1
Sequence:CCGGGCCCATTCTTTAAACCTTTATCTCGAGATAAAGGTTTAAAGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138435.1-1684s1c1
Sequence:CCGGGCCTCCTTGTTTACATGAAGTCTCGAGACTTCATGTAAACAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-712s1c1
Sequence:CCGGCCACTGGATCTTACAGGTTCACTCGAGTGAACCTGTAAGATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-674s1c1
Sequence:CCGGGTCATCAAGGTTCCTGATGGTCTCGAGACCATCAGGAACCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-1427s1c1
Sequence:CCGGGCCTAGCAACTGTGTGATTTCCTCGAGGAAATCACACAGTTGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-671s1c1
Sequence:CCGGCCTGTCATCAAGGTTCCTGATCTCGAGATCAGGAACCTTGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138435
FAM83F MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member F
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-552s21c1
Sequence:CCGGTGGTCAGGCAGATGATCCAACCTCGAGGTTGGATCATCTGCCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138435.2-1667s21c1
Sequence:CCGGGTCGCACACTGCACCAGTTTGCTCGAGCAAACTGGTGCAGTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-834s21c1
Sequence:CCGGTGATGGTGGACGGTGACAAAGCTCGAGCTTTGTCACCGTCCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138435.2-729s21c1
Sequence:CCGGAGCTCACTGACTTCCGGATTCCTCGAGGAATCCGGAAGTCAGTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-539s1c1
Sequence:CCGGCGAGGCAGGAGTGAAGTATTTCTCGAGAAATACTTCACTCCTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-488s1c1
Sequence:CCGGCATTGTGGATGCTGCCTGTAACTCGAGTTACAGGCAGCATCCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138435.1-1773s1c1
Sequence:CCGGGCCCATTCTTTAAACCTTTATCTCGAGATAAAGGTTTAAAGAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138435.1-1684s1c1
Sequence:CCGGGCCTCCTTGTTTACATGAAGTCTCGAGACTTCATGTAAACAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-712s1c1
Sequence:CCGGCCACTGGATCTTACAGGTTCACTCGAGTGAACCTGTAAGATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-674s1c1
Sequence:CCGGGTCATCAAGGTTCCTGATGGTCTCGAGACCATCAGGAACCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-1427s1c1
Sequence:CCGGGCCTAGCAACTGTGTGATTTCCTCGAGGAAATCACACAGTTGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138435.1-671s1c1
Sequence:CCGGCCTGTCATCAAGGTTCCTGATCTCGAGATCAGGAACCTTGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145986
FAM83F MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member F
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-1187s21c1
Sequence:CCGGGTCACAGTAGAGCAGATATTGCTCGAGCAATATCTGCTCTACTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-639s21c1
Sequence:CCGGTGGATGAGGGTGGAGTGAAATCTCGAGATTTCACTCCACCCTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-1503s21c1
Sequence:CCGGATGCCAACATATCAGGTAAAGCTCGAGCTTTACCTGATATGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145986.2-2099s21c1
Sequence:CCGGATGGTCTTCAGACGCTCATTTCTCGAGAAATGAGCGTCTGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-816s21c1
Sequence:CCGGCTACCGGCTCTTTCAGCTTTACTCGAGTAAAGCTGAAAGAGCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145986.1-1885s1c1
Sequence:CCGGGCCATTCTTTCTGCCTTGGTACTCGAGTACCAAGGCAGAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145986
FAM83F MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member F
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-1187s21c1
Sequence:CCGGGTCACAGTAGAGCAGATATTGCTCGAGCAATATCTGCTCTACTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-639s21c1
Sequence:CCGGTGGATGAGGGTGGAGTGAAATCTCGAGATTTCACTCCACCCTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-1503s21c1
Sequence:CCGGATGCCAACATATCAGGTAAAGCTCGAGCTTTACCTGATATGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145986.2-2099s21c1
Sequence:CCGGATGGTCTTCAGACGCTCATTTCTCGAGAAATGAGCGTCTGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-816s21c1
Sequence:CCGGCTACCGGCTCTTTCAGCTTTACTCGAGTAAAGCTGAAAGAGCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145986.1-1885s1c1
Sequence:CCGGGCCATTCTTTCTGCCTTGGTACTCGAGTACCAAGGCAGAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145986
FAM83F MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member F
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-1187s21c1
Sequence:CCGGGTCACAGTAGAGCAGATATTGCTCGAGCAATATCTGCTCTACTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-639s21c1
Sequence:CCGGTGGATGAGGGTGGAGTGAAATCTCGAGATTTCACTCCACCCTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-1503s21c1
Sequence:CCGGATGCCAACATATCAGGTAAAGCTCGAGCTTTACCTGATATGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145986.2-2099s21c1
Sequence:CCGGATGGTCTTCAGACGCTCATTTCTCGAGAAATGAGCGTCTGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145986.2-816s21c1
Sequence:CCGGCTACCGGCTCTTTCAGCTTTACTCGAGTAAAGCTGAAAGAGCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145986.1-1885s1c1
Sequence:CCGGGCCATTCTTTCTGCCTTGGTACTCGAGTACCAAGGCAGAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks