EMAIL THIS PAGE TO A FRIEND

FAM83G

family with sequence similarity 83, member G

54 Gene Product Result for
UniProtKB ID: A6ND36, Q3KQZ4, Q6ZW60
Gene ID:
Mouse(69640) family with sequence similarity 83, member G
Rat(100360307) family with sequence similarity 83, member G
chicken(770598) family with sequence similarity 83, member G
chicken(101666870) family with sequence similarity 83, member G
cow(100139162) family with sequence similarity 83, member G
domestic cat(101098664) family with sequence similarity 83, member G
dog(100682814) family with sequence similarity 83, member G
chicken(101751551) family with sequence similarity 83, member G
naked mole-rat(101722541) family with sequence similarity 83, member G
domestic guinea pig(100726723) family with sequence similarity 83, member G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039999 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086871 MISSION® esiRNA esiRNA human FAM83G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039999 Rosetta Predictions human pricing
NM_178618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228835 predicted 1428
2 SASI_Hs02_00308736 predicted 801
3 SASI_Hs01_00228837 predicted 1498
4 SASI_Hs01_00228838 predicted 1078
5 SASI_Hs01_00228839 predicted 1095
6 SASI_Hs01_00228840 predicted 1768
7 SASI_Hs02_00308737 predicted 777
8 SASI_Hs01_00228841 predicted 1072
9 SASI_Hs02_00308738 predicted 297
10 SASI_Hs02_00308739 predicted 2519
11 SASI_Hs01_00228836 predicted 2568
12 SASI_Hs01_00228842 predicted 1523
13 SASI_Hs01_00228843 predicted 1499
14 SASI_Hs01_00228844 predicted 2391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171895 predicted 1328
2 SASI_Mm01_00171896 predicted 1961
3 SASI_Mm01_00171897 predicted 736
4 SASI_Mm01_00171898 predicted 748
5 SASI_Mm01_00171899 predicted 1330
6 SASI_Mm01_00171900 predicted 1658
7 SASI_Mm01_00171901 predicted 1402
8 SASI_Mm01_00171902 predicted 1949
9 SASI_Mm01_00171903 predicted 2211
10 SASI_Mm02_00348980 predicted 1011
11 SASI_Mm01_00171894 predicted 2414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178618
VALIDATED
FAM83G MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member G
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178618.2-2082s1c1
Sequence:CCGGCGGAGCAGAGAAGATGTAGATCTCGAGATCTACATCTTCTCTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178618.2-2405s1c1
Sequence:CCGGCATACTCCAAATTGTCTCAATCTCGAGATTGAGACAATTTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178618.2-1280s1c1
Sequence:CCGGGAGGGCCAATATGTTTGAGTACTCGAGTACTCAAACATATTGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-1962s21c1
Sequence:CCGGCCATGTCAGACGAGTACTTTGCTCGAGCAAAGTACTCGTCTGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-2449s21c1
Sequence:CCGGCGGAATCCCATACTCCAAATTCTCGAGAATTTGGAGTATGGGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178618.3-2892s1c1
Sequence:CCGGCTACCCTCATCTCACAGATAACTCGAGTTATCTGTGAGATGAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178618.3-3414s21c1
Sequence:CCGGTGGCTGTGTCTGTAGTCATTTCTCGAGAAATGACTACAGACACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-748s21c1
Sequence:CCGGTGAGAGTAATGTCAAGTATTTCTCGAGAAATACTTGACATTACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-2471s21c1
Sequence:CCGGTCTCAATCGAAGCACCTAAAGCTCGAGCTTTAGGTGCTTCGATTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178618
VALIDATED
FAM83G MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member G
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178618.2-2082s1c1
Sequence:CCGGCGGAGCAGAGAAGATGTAGATCTCGAGATCTACATCTTCTCTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178618.2-2405s1c1
Sequence:CCGGCATACTCCAAATTGTCTCAATCTCGAGATTGAGACAATTTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178618.2-1280s1c1
Sequence:CCGGGAGGGCCAATATGTTTGAGTACTCGAGTACTCAAACATATTGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-1962s21c1
Sequence:CCGGCCATGTCAGACGAGTACTTTGCTCGAGCAAAGTACTCGTCTGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-2449s21c1
Sequence:CCGGCGGAATCCCATACTCCAAATTCTCGAGAATTTGGAGTATGGGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178618.3-2892s1c1
Sequence:CCGGCTACCCTCATCTCACAGATAACTCGAGTTATCTGTGAGATGAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178618.3-3414s21c1
Sequence:CCGGTGGCTGTGTCTGTAGTCATTTCTCGAGAAATGACTACAGACACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-748s21c1
Sequence:CCGGTGAGAGTAATGTCAAGTATTTCTCGAGAAATACTTGACATTACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-2471s21c1
Sequence:CCGGTCTCAATCGAAGCACCTAAAGCTCGAGCTTTAGGTGCTTCGATTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178618
VALIDATED
FAM83G MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member G
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178618.2-2082s1c1
Sequence:CCGGCGGAGCAGAGAAGATGTAGATCTCGAGATCTACATCTTCTCTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178618.2-2405s1c1
Sequence:CCGGCATACTCCAAATTGTCTCAATCTCGAGATTGAGACAATTTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178618.2-1280s1c1
Sequence:CCGGGAGGGCCAATATGTTTGAGTACTCGAGTACTCAAACATATTGGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-1962s21c1
Sequence:CCGGCCATGTCAGACGAGTACTTTGCTCGAGCAAAGTACTCGTCTGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-2449s21c1
Sequence:CCGGCGGAATCCCATACTCCAAATTCTCGAGAATTTGGAGTATGGGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178618.3-2892s1c1
Sequence:CCGGCTACCCTCATCTCACAGATAACTCGAGTTATCTGTGAGATGAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178618.3-3414s21c1
Sequence:CCGGTGGCTGTGTCTGTAGTCATTTCTCGAGAAATGACTACAGACACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-748s21c1
Sequence:CCGGTGAGAGTAATGTCAAGTATTTCTCGAGAAATACTTGACATTACTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178618.3-2471s21c1
Sequence:CCGGTCTCAATCGAAGCACCTAAAGCTCGAGCTTTAGGTGCTTCGATTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039999
VALIDATED
FAM83G MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 83, member G
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039999.2-780s21c1
Sequence:CCGGATCATCGTGGATGAGAGTAACCTCGAGGTTACTCTCATCCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039999.2-2281s21c1
Sequence:CCGGCCTCAGGGACTAGGGATAAAGCTCGAGCTTTATCCCTAGTCCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039999.2-1439s21c1
Sequence:CCGGCATCCTGGGCTACATCAATATCTCGAGATATTGATGTAGCCCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039999.2-2538s21c1
Sequence:CCGGTCTCAGTCGAAGCACCTAAAGCTCGAGCTTTAGGTGCTTCGACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039999
VALIDATED
FAM83G MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 83, member G
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039999.2-780s21c1
Sequence:CCGGATCATCGTGGATGAGAGTAACCTCGAGGTTACTCTCATCCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039999.2-2281s21c1
Sequence:CCGGCCTCAGGGACTAGGGATAAAGCTCGAGCTTTATCCCTAGTCCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039999.2-1439s21c1
Sequence:CCGGCATCCTGGGCTACATCAATATCTCGAGATATTGATGTAGCCCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039999.2-2538s21c1
Sequence:CCGGTCTCAGTCGAAGCACCTAAAGCTCGAGCTTTAGGTGCTTCGACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039999
VALIDATED
FAM83G MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 83, member G
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039999.2-780s21c1
Sequence:CCGGATCATCGTGGATGAGAGTAACCTCGAGGTTACTCTCATCCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039999.2-2281s21c1
Sequence:CCGGCCTCAGGGACTAGGGATAAAGCTCGAGCTTTATCCCTAGTCCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039999.2-1439s21c1
Sequence:CCGGCATCCTGGGCTACATCAATATCTCGAGATATTGATGTAGCCCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039999.2-2538s21c1
Sequence:CCGGTCTCAGTCGAAGCACCTAAAGCTCGAGCTTTAGGTGCTTCGACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks